Incidental Mutation 'R7992:Senp5'
ID 651836
Institutional Source Beutler Lab
Gene Symbol Senp5
Ensembl Gene ENSMUSG00000022772
Gene Name SUMO/sentrin specific peptidase 5
Synonyms 6230429P13Rik, A730063F07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 31959672-32003287 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 31977696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Isoleucine at position 617 (K617I)
Ref Sequence ENSEMBL: ENSMUSP00000023457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023457] [ENSMUST00000129900] [ENSMUST00000155515] [ENSMUST00000231360]
AlphaFold Q6NXL6
Predicted Effect probably damaging
Transcript: ENSMUST00000023457
AA Change: K617I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023457
Gene: ENSMUSG00000022772
AA Change: K617I

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
Pfam:Peptidase_C48 575 747 3.9e-45 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129900
AA Change: K590I
SMART Domains Protein: ENSMUSP00000115257
Gene: ENSMUSG00000022772
AA Change: K590I

DomainStartEndE-ValueType
low complexity region 414 425 N/A INTRINSIC
Pfam:Peptidase_C48 548 603 5.8e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155515
AA Change: K198I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117481
Gene: ENSMUSG00000022772
AA Change: K198I

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:Peptidase_C48 156 208 2.7e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000231360
AA Change: K617I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP5, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Arhgef37 T A 18: 61,505,756 E307D probably benign Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Senp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Senp5 APN 16 31989173 missense probably damaging 1.00
IGL00990:Senp5 APN 16 31990274 missense probably benign 0.00
IGL01707:Senp5 APN 16 31989770 missense probably damaging 0.99
IGL01923:Senp5 APN 16 31965816 missense probably damaging 1.00
IGL01997:Senp5 APN 16 31963470 missense probably damaging 0.97
IGL02273:Senp5 APN 16 31989872 missense probably benign 0.14
IGL02560:Senp5 APN 16 31989392 missense probably benign
IGL02651:Senp5 APN 16 31990079 missense probably benign 0.04
IGL02830:Senp5 APN 16 31983485 splice site probably benign
R0578:Senp5 UTSW 16 31989345 missense possibly damaging 0.75
R1879:Senp5 UTSW 16 31983824 missense probably damaging 1.00
R2153:Senp5 UTSW 16 31968874 missense probably damaging 1.00
R4903:Senp5 UTSW 16 31983299 missense probably damaging 1.00
R5092:Senp5 UTSW 16 31989142 missense probably benign 0.00
R5590:Senp5 UTSW 16 31989513 missense probably damaging 0.99
R6346:Senp5 UTSW 16 31983847 missense probably damaging 1.00
R6362:Senp5 UTSW 16 31989884 missense probably damaging 0.99
R6762:Senp5 UTSW 16 31989884 missense probably damaging 0.99
R7002:Senp5 UTSW 16 31983775 missense probably damaging 1.00
R7027:Senp5 UTSW 16 31989295 missense probably benign
R7436:Senp5 UTSW 16 31976029 missense unknown
R7721:Senp5 UTSW 16 31990434 start codon destroyed unknown
R7847:Senp5 UTSW 16 31990173 missense probably benign 0.25
R8081:Senp5 UTSW 16 31965759 missense probably damaging 1.00
R8147:Senp5 UTSW 16 31989310 missense probably benign 0.00
R8313:Senp5 UTSW 16 31989299 missense probably benign 0.10
R8353:Senp5 UTSW 16 31989348 missense probably benign 0.00
R8453:Senp5 UTSW 16 31989348 missense probably benign 0.00
R8506:Senp5 UTSW 16 31968901 missense probably damaging 1.00
R9079:Senp5 UTSW 16 31968900 missense probably damaging 1.00
R9317:Senp5 UTSW 16 31983572 missense probably damaging 1.00
R9776:Senp5 UTSW 16 31963461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGACTCAAGAGTTTACTAGTGCCC -3'
(R):5'- CAGGGCTGTACAGAGAAACC -3'

Sequencing Primer
(F):5'- GTGCCCTATTTTCCAAACATTAAGAC -3'
(R):5'- GGCTGTACAGAGAAACCCTGTCTC -3'
Posted On 2020-09-15