Incidental Mutation 'R7992:Pdzph1'
ID 651837
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 046033-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59186105 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1229 (M1229L)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064] [ENSMUST00000177360]
AlphaFold Q8BGR1
Predicted Effect possibly damaging
Transcript: ENSMUST00000025064
AA Change: M1229L

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: M1229L

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177360
AA Change: M189L

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000135180
Gene: ENSMUSG00000024227
AA Change: M189L

DomainStartEndE-ValueType
SCOP:d1faoa_ 1 54 1e-4 SMART
Blast:PH 1 56 4e-33 BLAST
PH 80 178 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,904 (GRCm39) T1054A probably benign Het
Ankfn1 A C 11: 89,413,859 (GRCm39) I172S probably benign Het
Ano3 T C 2: 110,605,367 (GRCm39) T280A possibly damaging Het
Arhgef37 T A 18: 61,638,827 (GRCm39) E307D probably benign Het
Bptf C T 11: 107,001,709 (GRCm39) V468I probably benign Het
Ces1b A G 8: 93,786,987 (GRCm39) V464A probably benign Het
Cmc2 A T 8: 117,616,446 (GRCm39) L93* probably null Het
Ddx60 A G 8: 62,407,569 (GRCm39) D360G probably benign Het
Dock6 C T 9: 21,744,135 (GRCm39) probably null Het
Erp44 A G 4: 48,218,136 (GRCm39) F178L possibly damaging Het
Fam47e T C 5: 92,722,541 (GRCm39) V79A probably damaging Het
Fancd2 T C 6: 113,542,165 (GRCm39) S770P probably damaging Het
Fcgr1 A G 3: 96,191,897 (GRCm39) F304L probably benign Het
Fkbp15 T C 4: 62,230,538 (GRCm39) E725G probably damaging Het
Fn1 T C 1: 71,638,825 (GRCm39) I1971V probably benign Het
Gdf6 A G 4: 9,844,652 (GRCm39) S59G probably benign Het
Gm5773 T A 3: 93,680,373 (GRCm39) I15N possibly damaging Het
Hesx1 T C 14: 26,723,379 (GRCm39) S70P probably benign Het
Htr5a T C 5: 28,055,995 (GRCm39) S329P probably damaging Het
Htt T C 5: 34,987,225 (GRCm39) probably null Het
Iba57 T A 11: 59,052,288 (GRCm39) M118L unknown Het
Ifi35 C T 11: 101,348,307 (GRCm39) Q112* probably null Het
Il12rb1 G T 8: 71,265,233 (GRCm39) R183L possibly damaging Het
Il12rb2 A T 6: 67,328,311 (GRCm39) Y306* probably null Het
Ints1 C G 5: 139,742,282 (GRCm39) D1722H probably damaging Het
Ipp T G 4: 116,381,453 (GRCm39) D317E probably damaging Het
Kif26a A G 12: 112,142,481 (GRCm39) T912A probably benign Het
Klhdc7a A G 4: 139,693,045 (GRCm39) V634A probably damaging Het
Klhl40 C A 9: 121,607,748 (GRCm39) P303T probably damaging Het
Krt13 T C 11: 100,008,478 (GRCm39) T420A unknown Het
Lpcat2 T C 8: 93,582,186 (GRCm39) F35S probably damaging Het
Macf1 A G 4: 123,289,753 (GRCm39) V5470A probably damaging Het
Mta2 T C 19: 8,925,151 (GRCm39) probably null Het
Muc16 G T 9: 18,567,725 (GRCm39) T1598K unknown Het
Nckap5 A T 1: 125,954,547 (GRCm39) N668K probably damaging Het
Nlrp4a A T 7: 26,150,070 (GRCm39) D559V possibly damaging Het
Npat T C 9: 53,474,167 (GRCm39) L653P probably benign Het
Oog1 G A 12: 87,655,252 (GRCm39) V467I possibly damaging Het
Or4c15b A G 2: 89,113,082 (GRCm39) S132P probably benign Het
Or4f56 C T 2: 111,703,280 (GRCm39) A307T probably benign Het
Piwil4 T A 9: 14,614,445 (GRCm39) Q106L Het
Plekha5 C A 6: 140,472,267 (GRCm39) R65S probably damaging Het
Ptger4 T C 15: 5,264,381 (GRCm39) Y425C probably damaging Het
Pus7 A G 5: 23,951,465 (GRCm39) M534T possibly damaging Het
Rtkn2 C T 10: 67,875,923 (GRCm39) P411S probably damaging Het
Scand1 G A 2: 156,154,232 (GRCm39) P13S unknown Het
Scaper T C 9: 55,765,438 (GRCm39) H550R probably benign Het
Senp5 T A 16: 31,796,514 (GRCm39) K617I probably damaging Het
Shq1 A G 6: 100,613,972 (GRCm39) L282P probably damaging Het
Slc12a6 T A 2: 112,166,256 (GRCm39) C227S probably damaging Het
Slc5a9 T A 4: 111,747,729 (GRCm39) T284S probably benign Het
Stat2 T A 10: 128,120,831 (GRCm39) F579L probably damaging Het
Tes G T 6: 17,096,242 (GRCm39) A77S possibly damaging Het
Themis A T 10: 28,637,342 (GRCm39) T149S probably benign Het
Tmprss6 C T 15: 78,326,664 (GRCm39) R653H probably benign Het
Trmt6 G A 2: 132,652,959 (GRCm39) L107F probably damaging Het
Trpm6 T C 19: 18,792,714 (GRCm39) C713R probably damaging Het
Trpm7 T C 2: 126,667,454 (GRCm39) I820V probably benign Het
Usp45 G A 4: 21,824,543 (GRCm39) A432T probably benign Het
Xab2 A T 8: 3,668,622 (GRCm39) V82E possibly damaging Het
Zfp938 T A 10: 82,061,777 (GRCm39) Y281F possibly damaging Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8898:Pdzph1 UTSW 17 59,281,334 (GRCm39) missense probably benign 0.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGGCTTTAATGTAAGTGC -3'
(R):5'- AATCCACAGAGCATGTTTATCCC -3'

Sequencing Primer
(F):5'- CCTAGGCTTTAATGTAAGTGCAGTAC -3'
(R):5'- CAGAGCATGTTTATCCCATTAATTCC -3'
Posted On 2020-09-15