Incidental Mutation 'R7992:Arhgef37'
ID 651838
Institutional Source Beutler Lab
Gene Symbol Arhgef37
Ensembl Gene ENSMUSG00000045094
Gene Name Rho guanine nucleotide exchange factor (GEF) 37
Synonyms 4933429F08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R7992 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 61493794-61536536 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61505756 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 307 (E307D)
Ref Sequence ENSEMBL: ENSMUSP00000130560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171629]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000171629
AA Change: E307D

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130560
Gene: ENSMUSG00000045094
AA Change: E307D

DomainStartEndE-ValueType
RhoGEF 34 212 2.62e-35 SMART
Pfam:BAR 311 444 5.6e-10 PFAM
SH3 509 568 8.06e-1 SMART
SH3 606 665 2.56e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 A G 15: 11,310,818 T1054A probably benign Het
Ankfn1 A C 11: 89,523,033 I172S probably benign Het
Ano3 T C 2: 110,775,022 T280A possibly damaging Het
Bptf C T 11: 107,110,883 V468I probably benign Het
Ces1b A G 8: 93,060,359 V464A probably benign Het
Cmc2 A T 8: 116,889,707 L93* probably null Het
Ddx60 A G 8: 61,954,535 D360G probably benign Het
Dock6 C T 9: 21,832,839 probably null Het
Erp44 A G 4: 48,218,136 F178L possibly damaging Het
Fam47e T C 5: 92,574,682 V79A probably damaging Het
Fancd2 T C 6: 113,565,204 S770P probably damaging Het
Fcgr1 A G 3: 96,284,581 F304L probably benign Het
Fkbp15 T C 4: 62,312,301 E725G probably damaging Het
Fn1 T C 1: 71,599,666 I1971V probably benign Het
Gdf6 A G 4: 9,844,652 S59G probably benign Het
Gm5773 T A 3: 93,773,066 I15N possibly damaging Het
Hesx1 T C 14: 27,001,422 S70P probably benign Het
Htr5a T C 5: 27,850,997 S329P probably damaging Het
Htt T C 5: 34,829,881 probably null Het
Iba57 T A 11: 59,161,462 M118L unknown Het
Ifi35 C T 11: 101,457,481 Q112* probably null Het
Il12rb1 G T 8: 70,812,589 R183L possibly damaging Het
Il12rb2 A T 6: 67,351,327 Y306* probably null Het
Ints1 C G 5: 139,756,527 D1722H probably damaging Het
Ipp T G 4: 116,524,256 D317E probably damaging Het
Kif26a A G 12: 112,176,047 T912A probably benign Het
Klhdc7a A G 4: 139,965,734 V634A probably damaging Het
Klhl40 C A 9: 121,778,682 P303T probably damaging Het
Krt13 T C 11: 100,117,652 T420A unknown Het
Lpcat2 T C 8: 92,855,558 F35S probably damaging Het
Macf1 A G 4: 123,395,960 V5470A probably damaging Het
Mta2 T C 19: 8,947,787 probably null Het
Muc16 G T 9: 18,656,429 T1598K unknown Het
Nckap5 A T 1: 126,026,810 N668K probably damaging Het
Nlrp4a A T 7: 26,450,645 D559V possibly damaging Het
Npat T C 9: 53,562,867 L653P probably benign Het
Olfr1229 A G 2: 89,282,738 S132P probably benign Het
Olfr1305 C T 2: 111,872,935 A307T probably benign Het
Oog1 G A 12: 87,608,482 V467I possibly damaging Het
Pdzph1 T A 17: 58,879,110 M1229L possibly damaging Het
Piwil4 T A 9: 14,703,149 Q106L Het
Plekha5 C A 6: 140,526,541 R65S probably damaging Het
Ptger4 T C 15: 5,234,900 Y425C probably damaging Het
Pus7 A G 5: 23,746,467 M534T possibly damaging Het
Rtkn2 C T 10: 68,040,093 P411S probably damaging Het
Scand1 G A 2: 156,312,312 P13S unknown Het
Scaper T C 9: 55,858,154 H550R probably benign Het
Senp5 T A 16: 31,977,696 K617I probably damaging Het
Shq1 A G 6: 100,637,011 L282P probably damaging Het
Slc12a6 T A 2: 112,335,911 C227S probably damaging Het
Slc5a9 T A 4: 111,890,532 T284S probably benign Het
Stat2 T A 10: 128,284,962 F579L probably damaging Het
Tes G T 6: 17,096,243 A77S possibly damaging Het
Themis A T 10: 28,761,346 T149S probably benign Het
Tmprss6 C T 15: 78,442,464 R653H probably benign Het
Trmt6 G A 2: 132,811,039 L107F probably damaging Het
Trpm6 T C 19: 18,815,350 C713R probably damaging Het
Trpm7 T C 2: 126,825,534 I820V probably benign Het
Usp45 G A 4: 21,824,543 A432T probably benign Het
Xab2 A T 8: 3,618,622 V82E possibly damaging Het
Zfp938 T A 10: 82,225,943 Y281F possibly damaging Het
Other mutations in Arhgef37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Arhgef37 APN 18 61523871 missense probably damaging 1.00
IGL00801:Arhgef37 APN 18 61499834 missense probably damaging 1.00
IGL01146:Arhgef37 APN 18 61518010 missense possibly damaging 0.93
IGL02052:Arhgef37 APN 18 61499768 missense probably damaging 1.00
IGL02489:Arhgef37 APN 18 61506469 missense possibly damaging 0.91
IGL03236:Arhgef37 APN 18 61523826 missense probably damaging 1.00
R0715:Arhgef37 UTSW 18 61508789 missense probably damaging 0.98
R0746:Arhgef37 UTSW 18 61517993 critical splice donor site probably null
R1843:Arhgef37 UTSW 18 61518050 missense probably damaging 0.99
R1934:Arhgef37 UTSW 18 61523943 missense probably benign 0.00
R1980:Arhgef37 UTSW 18 61508696 missense probably damaging 0.98
R2012:Arhgef37 UTSW 18 61504356 missense possibly damaging 0.56
R2237:Arhgef37 UTSW 18 61504406 missense probably damaging 1.00
R3024:Arhgef37 UTSW 18 61501888 missense probably damaging 0.96
R4864:Arhgef37 UTSW 18 61494925 missense probably benign
R4876:Arhgef37 UTSW 18 61498239 nonsense probably null
R5024:Arhgef37 UTSW 18 61506440 missense probably damaging 0.99
R5050:Arhgef37 UTSW 18 61504331 missense probably benign 0.43
R5512:Arhgef37 UTSW 18 61499774 nonsense probably null
R5611:Arhgef37 UTSW 18 61507263 missense probably benign 0.03
R6051:Arhgef37 UTSW 18 61507274 missense probably damaging 0.97
R6488:Arhgef37 UTSW 18 61518052 missense probably benign 0.43
R6612:Arhgef37 UTSW 18 61494881 missense probably benign
R7117:Arhgef37 UTSW 18 61504410 missense probably benign 0.00
R7351:Arhgef37 UTSW 18 61498215 missense possibly damaging 0.93
R7426:Arhgef37 UTSW 18 61504385 missense probably damaging 1.00
R7571:Arhgef37 UTSW 18 61504332 missense probably damaging 0.97
R8493:Arhgef37 UTSW 18 61507206 missense probably benign 0.03
R8936:Arhgef37 UTSW 18 61523877 missense probably damaging 0.98
R9000:Arhgef37 UTSW 18 61504262 missense possibly damaging 0.81
R9053:Arhgef37 UTSW 18 61508689 missense probably damaging 1.00
R9298:Arhgef37 UTSW 18 61518001 missense probably damaging 0.98
R9490:Arhgef37 UTSW 18 61508836 missense probably damaging 1.00
R9559:Arhgef37 UTSW 18 61507196 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAATTGTGTAAGTGCCTGACTTC -3'
(R):5'- AGTGTGGCCTCAAAGGAGTG -3'

Sequencing Primer
(F):5'- GACTTCTAAATATTACCCTTGTCGG -3'
(R):5'- TCTAATCCCCCAGGTTGAGCAG -3'
Posted On 2020-09-15