Incidental Mutation 'R7993:Svs1'
ID651862
Institutional Source Beutler Lab
Gene Symbol Svs1
Ensembl Gene ENSMUSG00000039215
Gene Nameseminal vesicle secretory protein 1
SynonymsSVS I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7993 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location48986861-48991722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48987608 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 183 (N183K)
Ref Sequence ENSEMBL: ENSMUSP00000045221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037696
AA Change: N183K

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045221
Gene: ENSMUSG00000039215
AA Change: N183K

DomainStartEndE-ValueType
Pfam:Cu_amine_oxidN2 44 130 1.5e-24 PFAM
Pfam:Cu_amine_oxidN3 146 246 2.7e-16 PFAM
internal_repeat_1 286 342 7.28e-22 PROSPERO
Pfam:Cu_amine_oxid 408 811 2e-92 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,263,133 K462N probably benign Het
Abcc2 T A 19: 43,814,792 V689D possibly damaging Het
Adamts17 T C 7: 66,849,864 V53A possibly damaging Het
Adcy9 T C 16: 4,418,002 N515S probably damaging Het
Atp1a2 A G 1: 172,291,311 V88A possibly damaging Het
Atp1a3 T C 7: 25,000,981 probably null Het
Baz2a T C 10: 128,125,622 F1706L probably benign Het
Cacnb2 A C 2: 14,963,920 N199T probably benign Het
Caskin1 T A 17: 24,499,305 Y296* probably null Het
Cemip C A 7: 83,964,175 G605V probably damaging Het
Ciart T A 3: 95,878,894 K290* probably null Het
Cideb G T 14: 55,758,442 probably benign Het
Copg2 A T 6: 30,816,162 Y413N probably damaging Het
Csrp1 T A 1: 135,746,715 probably null Het
Cyp2j8 C T 4: 96,447,219 probably null Het
Dcbld1 T A 10: 52,261,788 Y49* probably null Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
Exoc2 A G 13: 30,906,730 probably null Het
Fcho2 A T 13: 98,752,016 probably null Het
Foxd3 C T 4: 99,656,604 probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gipc3 T C 10: 81,337,971 D269G probably damaging Het
Gm14409 C T 2: 177,265,222 G161D probably damaging Het
Gm4861 G A 3: 137,550,656 T63M probably damaging Het
Hmga1b C A 11: 120,763,007 A40E probably damaging Het
Hydin T A 8: 110,579,632 M3889K probably benign Het
Klk14 T A 7: 43,694,943 M226K probably benign Het
Liph T G 16: 21,958,812 M413L probably benign Het
Lrrc37a T C 11: 103,457,961 D2636G unknown Het
Lrrk1 G A 7: 66,262,454 T1786M probably benign Het
Map1a A G 2: 121,304,576 S1958G possibly damaging Het
Msto1 A G 3: 88,910,174 F484S probably benign Het
Muc2 C T 7: 141,754,436 H890Y Het
Nectin3 T C 16: 46,458,821 I265V probably benign Het
Nectin4 C T 1: 171,383,754 T282I probably damaging Het
Nfat5 T A 8: 107,355,502 probably null Het
Nsmaf T C 4: 6,398,647 D819G probably benign Het
Olfr145 A T 9: 37,897,337 probably benign Het
Pcdhb1 A T 18: 37,266,991 D665V probably damaging Het
Pkd1l1 T C 11: 8,945,262 D616G Het
Plppr2 A T 9: 21,946,962 H286L probably damaging Het
Polrmt T C 10: 79,736,251 T1203A probably damaging Het
Ppm1d T A 11: 85,326,951 V180E probably damaging Het
Ppp1r18 T A 17: 35,873,826 I551N probably benign Het
Psg28 C T 7: 18,426,476 C265Y possibly damaging Het
Psmc1 A G 12: 100,115,565 D142G probably benign Het
Rabgap1l G T 1: 160,700,854 A394E probably damaging Het
Rbm48 G A 5: 3,590,470 P303L probably benign Het
Rnf167 T C 11: 70,649,995 V185A probably benign Het
Ros1 T A 10: 52,123,347 Q1169L probably benign Het
Rrp1b A G 17: 32,058,567 D607G probably damaging Het
Scamp1 A G 13: 94,229,786 Y134H probably damaging Het
Scfd1 G A 12: 51,445,707 E600K probably damaging Het
Scn3b A G 9: 40,282,544 E189G possibly damaging Het
Scn4b G T 9: 45,147,709 V93L probably benign Het
Serpina3i A T 12: 104,265,148 T15S possibly damaging Het
Slc2a13 A T 15: 91,412,153 C319* probably null Het
Tdrd1 A G 19: 56,866,005 probably null Het
Tep1 T A 14: 50,830,253 I2169F probably benign Het
Tm4sf19 A G 16: 32,407,640 D124G possibly damaging Het
Trim2 T C 3: 84,190,719 Y434C probably damaging Het
Usp34 T A 11: 23,377,622 S1056T Het
Vmn1r230 T A 17: 20,847,050 M167K probably benign Het
Vmn2r14 T A 5: 109,215,996 M685L probably benign Het
Zfhx4 T A 3: 5,412,987 V3554D probably damaging Het
Zfp458 A G 13: 67,257,170 S402P probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zmat5 G A 11: 4,722,379 probably benign Het
Znfx1 C A 2: 167,055,937 E356* probably null Het
Zswim5 A G 4: 116,951,094 T292A probably benign Het
Other mutations in Svs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Svs1 APN 6 48987739 missense probably damaging 0.98
IGL01876:Svs1 APN 6 48990036 missense possibly damaging 0.71
IGL01934:Svs1 APN 6 48988761 missense probably damaging 0.97
IGL03002:Svs1 APN 6 48987118 missense probably benign 0.01
IGL03059:Svs1 APN 6 48987415 missense probably benign 0.13
IGL03213:Svs1 APN 6 48988345 missense possibly damaging 0.92
IGL03249:Svs1 APN 6 48988369 missense probably benign
IGL03365:Svs1 APN 6 48988597 missense probably damaging 0.97
PIT4280001:Svs1 UTSW 6 48987120 missense probably benign 0.01
PIT4495001:Svs1 UTSW 6 48987776 missense possibly damaging 0.92
R0010:Svs1 UTSW 6 48988906 missense probably damaging 0.99
R0528:Svs1 UTSW 6 48988031 missense probably benign
R0784:Svs1 UTSW 6 48987301 missense possibly damaging 0.78
R0959:Svs1 UTSW 6 48988632 missense possibly damaging 0.89
R1173:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1174:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1175:Svs1 UTSW 6 48990239 missense probably damaging 1.00
R1940:Svs1 UTSW 6 48990073 nonsense probably null
R3115:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3116:Svs1 UTSW 6 48987397 missense probably damaging 0.99
R3808:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3809:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R3852:Svs1 UTSW 6 48987994 missense possibly damaging 0.93
R4455:Svs1 UTSW 6 48987460 missense possibly damaging 0.56
R4898:Svs1 UTSW 6 48987717 missense possibly damaging 0.95
R4933:Svs1 UTSW 6 48987492 missense probably damaging 1.00
R5108:Svs1 UTSW 6 48988570 missense probably damaging 0.97
R5320:Svs1 UTSW 6 48987575 missense probably benign 0.02
R6053:Svs1 UTSW 6 48988488 missense probably benign 0.42
R6728:Svs1 UTSW 6 48988845 missense possibly damaging 0.86
R6922:Svs1 UTSW 6 48987574 missense probably damaging 0.99
R7045:Svs1 UTSW 6 48988612 missense possibly damaging 0.81
R7046:Svs1 UTSW 6 48987578 missense probably benign 0.11
R7137:Svs1 UTSW 6 48990149 missense probably damaging 1.00
R7267:Svs1 UTSW 6 48988018 small deletion probably benign
R7874:Svs1 UTSW 6 48988666 missense possibly damaging 0.91
R8238:Svs1 UTSW 6 48990041 missense probably damaging 0.96
X0022:Svs1 UTSW 6 48988339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAATGTCACCGAGTATGC -3'
(R):5'- ACTTGCCGTTATACCAGACTTG -3'

Sequencing Primer
(F):5'- CAATGTCACCGAGTATGCTGTGG -3'
(R):5'- ATACCAGACTTGTTCTACTATCCAG -3'
Posted On2020-09-15