Mutagenetix > Incidental Mutation

Incidental Mutation 'R7993:Muc2'

651869

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

046034-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R7993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

141276583-141308428 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 141308173 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 890 (H890Y)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000026590
AA Change: H451Y

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: H451Y

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	T	A	19: 43,803,231 (GRCm39)	V689D	possibly damaging	Het
Adamts17	T	C	7: 66,499,612 (GRCm39)	V53A	possibly damaging	Het
Adcy9	T	C	16: 4,235,866 (GRCm39)	N515S	probably damaging	Het
Aoc1l3	T	A	6: 48,964,542 (GRCm39)	N183K	possibly damaging	Het
Atp1a2	A	G	1: 172,118,878 (GRCm39)	V88A	possibly damaging	Het
Atp1a3	T	C	7: 24,700,406 (GRCm39)		probably null	Het
Baz2a	T	C	10: 127,961,491 (GRCm39)	F1706L	probably benign	Het
Cacnb2	A	C	2: 14,968,731 (GRCm39)	N199T	probably benign	Het
Caskin1	T	A	17: 24,718,279 (GRCm39)	Y296*	probably null	Het
Cemip	C	A	7: 83,613,383 (GRCm39)	G605V	probably damaging	Het
Ciart	T	A	3: 95,786,206 (GRCm39)	K290*	probably null	Het
Cideb	G	T	14: 55,995,899 (GRCm39)		probably benign	Het
Copg2	A	T	6: 30,793,097 (GRCm39)	Y413N	probably damaging	Het
Csrp1	T	A	1: 135,674,453 (GRCm39)		probably null	Het
Cyp2j8	C	T	4: 96,335,456 (GRCm39)		probably null	Het
Dcbld1	T	A	10: 52,137,884 (GRCm39)	Y49*	probably null	Het
Dpep1	T	C	8: 123,927,460 (GRCm39)	V338A	possibly damaging	Het
Exoc2	A	G	13: 31,090,713 (GRCm39)		probably null	Het
Fcho2	A	T	13: 98,888,524 (GRCm39)		probably null	Het
Foxd3	C	T	4: 99,544,841 (GRCm39)		probably benign	Het
Gabbr2	C	T	4: 46,736,349 (GRCm39)		probably null	Het
Gipc3	T	C	10: 81,173,805 (GRCm39)	D269G	probably damaging	Het
Gm4861	G	A	3: 137,256,417 (GRCm39)	T63M	probably damaging	Het
Hmga1b	C	A	11: 120,653,833 (GRCm39)	A40E	probably damaging	Het
Hydin	T	A	8: 111,306,264 (GRCm39)	M3889K	probably benign	Het
Inhca	T	A	9: 103,140,332 (GRCm39)	K462N	probably benign	Het
Klk14	T	A	7: 43,344,367 (GRCm39)	M226K	probably benign	Het
Liph	T	G	16: 21,777,562 (GRCm39)	M413L	probably benign	Het
Lrrc37a	T	C	11: 103,348,787 (GRCm39)	D2636G	unknown	Het
Lrrk1	G	A	7: 65,912,202 (GRCm39)	T1786M	probably benign	Het
Map1a	A	G	2: 121,135,057 (GRCm39)	S1958G	possibly damaging	Het
Msto1	A	G	3: 88,817,481 (GRCm39)	F484S	probably benign	Het
Nectin3	T	C	16: 46,279,184 (GRCm39)	I265V	probably benign	Het
Nectin4	C	T	1: 171,211,322 (GRCm39)	T282I	probably damaging	Het
Nfat5	T	A	8: 108,082,134 (GRCm39)		probably null	Het
Nsmaf	T	C	4: 6,398,647 (GRCm39)	D819G	probably benign	Het
Or8b8	A	T	9: 37,808,633 (GRCm39)		probably benign	Het
Pcdhb1	A	T	18: 37,400,044 (GRCm39)	D665V	probably damaging	Het
Pkd1l1	T	C	11: 8,895,262 (GRCm39)	D616G		Het
Plppr2	A	T	9: 21,858,258 (GRCm39)	H286L	probably damaging	Het
Polrmt	T	C	10: 79,572,085 (GRCm39)	T1203A	probably damaging	Het
Ppm1d	T	A	11: 85,217,777 (GRCm39)	V180E	probably damaging	Het
Ppp1r18	T	A	17: 36,184,718 (GRCm39)	I551N	probably benign	Het
Psg28	C	T	7: 18,160,401 (GRCm39)	C265Y	possibly damaging	Het
Psmc1	A	G	12: 100,081,824 (GRCm39)	D142G	probably benign	Het
Rabgap1l	G	T	1: 160,528,424 (GRCm39)	A394E	probably damaging	Het
Rbm48	G	A	5: 3,640,470 (GRCm39)	P303L	probably benign	Het
Rnf167	T	C	11: 70,540,821 (GRCm39)	V185A	probably benign	Het
Ros1	T	A	10: 51,999,443 (GRCm39)	Q1169L	probably benign	Het
Rrp1b	A	G	17: 32,277,541 (GRCm39)	D607G	probably damaging	Het
Scamp1	A	G	13: 94,366,294 (GRCm39)	Y134H	probably damaging	Het
Scfd1	G	A	12: 51,492,490 (GRCm39)	E600K	probably damaging	Het
Scn3b	A	G	9: 40,193,840 (GRCm39)	E189G	possibly damaging	Het
Scn4b	G	T	9: 45,059,007 (GRCm39)	V93L	probably benign	Het
Serpina3i	A	T	12: 104,231,407 (GRCm39)	T15S	possibly damaging	Het
Slc2a13	A	T	15: 91,296,356 (GRCm39)	C319*	probably null	Het
Tdrd1	A	G	19: 56,854,437 (GRCm39)		probably null	Het
Tep1	T	A	14: 51,067,710 (GRCm39)	I2169F	probably benign	Het
Tm4sf19	A	G	16: 32,226,458 (GRCm39)	D124G	possibly damaging	Het
Trim2	T	C	3: 84,098,026 (GRCm39)	Y434C	probably damaging	Het
Usp34	T	A	11: 23,327,622 (GRCm39)	S1056T		Het
Vmn1r230	T	A	17: 21,067,312 (GRCm39)	M167K	probably benign	Het
Vmn2r14	T	A	5: 109,363,862 (GRCm39)	M685L	probably benign	Het
Zfhx4	T	A	3: 5,478,047 (GRCm39)	V3554D	probably damaging	Het
Zfp1010	C	T	2: 176,957,015 (GRCm39)	G161D	probably damaging	Het
Zfp458	A	G	13: 67,405,234 (GRCm39)	S402P	probably damaging	Het
Zfp462	C	A	4: 55,011,907 (GRCm39)	A1291E	probably damaging	Het
Zmat5	G	A	11: 4,672,379 (GRCm39)		probably benign	Het
Znfx1	C	A	2: 166,897,857 (GRCm39)	E356*	probably null	Het
Zswim5	A	G	4: 116,808,291 (GRCm39)	T292A	probably benign	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141,693,356 (GRCm38)	missense	probably benign	0.35
kenny	APN	7	0 ()	nonsense
Winnie	APN	7	141,286,029 (GRCm39)	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141,306,132 (GRCm39)	missense	probably benign
IGL01482:Muc2	APN	7	141,307,797 (GRCm39)	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141,306,477 (GRCm39)	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141,305,241 (GRCm39)	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141,305,609 (GRCm39)	nonsense	probably null
IGL02548:Muc2	APN	7	141,305,594 (GRCm39)	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141,300,450 (GRCm39)	unclassified	probably benign
IGL03196:Muc2	APN	7	141,301,367 (GRCm39)	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141,307,176 (GRCm39)	missense	unknown
nomoco	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
Schlendrian	UTSW	7	141,281,925 (GRCm39)	missense	probably damaging	1.00
Seco	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141,282,598 (GRCm39)	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141,302,691 (GRCm39)	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141,302,708 (GRCm39)	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0299:Muc2	UTSW	7	141,306,466 (GRCm39)	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R0699:Muc2	UTSW	7	141,306,037 (GRCm39)	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1348:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141,302,711 (GRCm39)	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141,283,405 (GRCm39)	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141,287,444 (GRCm39)	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R2163:Muc2	UTSW	7	141,699,185 (GRCm38)	frame shift	probably null
R3008:Muc2	UTSW	7	141,281,347 (GRCm39)	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3112:Muc2	UTSW	7	141,299,225 (GRCm39)	unclassified	probably benign
R3424:Muc2	UTSW	7	141,279,595 (GRCm39)	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141,283,590 (GRCm39)	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141,308,081 (GRCm39)	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141,286,233 (GRCm39)	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3974:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R3976:Muc2	UTSW	7	141,300,541 (GRCm39)	unclassified	probably benign
R4327:Muc2	UTSW	7	141,281,577 (GRCm39)	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141,306,082 (GRCm39)	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141,299,345 (GRCm39)	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141,286,260 (GRCm39)	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141,307,877 (GRCm39)	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141,303,280 (GRCm39)	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141,307,456 (GRCm39)	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141,305,169 (GRCm39)	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141,277,446 (GRCm39)	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141,299,381 (GRCm39)	unclassified	probably benign
R5919:Muc2	UTSW	7	141,281,171 (GRCm39)	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141,287,951 (GRCm39)	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141,305,143 (GRCm39)	missense	probably damaging	0.99
R5979:Muc2	UTSW	7	141,283,493 (GRCm39)	splice site	probably null
R6175:Muc2	UTSW	7	141,282,875 (GRCm39)	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141,305,151 (GRCm39)	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141,306,140 (GRCm39)	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141,287,397 (GRCm39)	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141,305,883 (GRCm39)	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141,300,473 (GRCm39)	unclassified	probably benign
R6582:Muc2	UTSW	7	141,282,941 (GRCm39)	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141,305,214 (GRCm39)	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141,306,432 (GRCm39)	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141,284,976 (GRCm39)	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141,284,077 (GRCm39)	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141,305,194 (GRCm39)	missense	unknown
R7222:Muc2	UTSW	7	141,290,758 (GRCm39)	missense
R7251:Muc2	UTSW	7	141,278,965 (GRCm39)	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141,306,481 (GRCm39)	missense
R7315:Muc2	UTSW	7	141,276,645 (GRCm39)	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141,301,863 (GRCm39)	missense
R7556:Muc2	UTSW	7	141,307,439 (GRCm39)	missense
R7651:Muc2	UTSW	7	141,290,750 (GRCm39)	missense
R7710:Muc2	UTSW	7	141,287,452 (GRCm39)	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141,290,942 (GRCm39)	missense
R7813:Muc2	UTSW	7	141,282,543 (GRCm39)	splice site	probably null
R7843:Muc2	UTSW	7	141,281,662 (GRCm39)	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141,303,471 (GRCm39)	missense
R7924:Muc2	UTSW	7	141,281,631 (GRCm39)	missense	probably damaging	1.00
R8053:Muc2	UTSW	7	141,284,575 (GRCm39)	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141,298,422 (GRCm39)	missense
R8099:Muc2	UTSW	7	141,299,175 (GRCm39)	splice site	probably null
R8192:Muc2	UTSW	7	141,305,215 (GRCm39)	missense
R8194:Muc2	UTSW	7	141,290,801 (GRCm39)	missense
R8545:Muc2	UTSW	7	141,306,130 (GRCm39)	missense	unknown
R8701:Muc2	UTSW	7	141,281,850 (GRCm39)	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141,287,469 (GRCm39)	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141,280,758 (GRCm39)	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141,279,643 (GRCm39)	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141,287,936 (GRCm39)	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141,287,058 (GRCm39)	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9104:Muc2	UTSW	7	141,286,224 (GRCm39)	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141,287,983 (GRCm39)	nonsense	probably null
R9270:Muc2	UTSW	7	141,290,816 (GRCm39)	missense
R9297:Muc2	UTSW	7	141,302,759 (GRCm39)	missense
R9325:Muc2	UTSW	7	141,298,559 (GRCm39)	missense
R9354:Muc2	UTSW	7	141,307,157 (GRCm39)	missense
R9386:Muc2	UTSW	7	141,279,389 (GRCm39)	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141,287,453 (GRCm39)	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141,308,242 (GRCm39)	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141,300,559 (GRCm39)	missense
R9607:Muc2	UTSW	7	141,305,190 (GRCm39)	missense
R9646:Muc2	UTSW	7	141,276,643 (GRCm39)	missense	probably benign
R9651:Muc2	UTSW	7	141,288,014 (GRCm39)	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141,285,811 (GRCm39)	missense	probably benign
R9784:Muc2	UTSW	7	141,280,785 (GRCm39)	nonsense	probably null
Z1176:Muc2	UTSW	7	141,300,451 (GRCm39)	missense
Z1177:Muc2	UTSW	7	141,298,531 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- TGATGCTGTTCACAGGGAGG -3'
(R):5'- GCCTGAGTTTATTATCGGAAAGC -3'

Sequencing Primer
(F):5'- AGGCTGGCACTCATTTTGC -3'
(R):5'- ACTCCGAAAATAAATATGTGCAGAG -3'

Posted On

2020-09-15