Incidental Mutation 'R7993:Usp34'
ID 651884
Institutional Source Beutler Lab
Gene Symbol Usp34
Ensembl Gene ENSMUSG00000056342
Gene Name ubiquitin specific peptidase 34
Synonyms Murr2, A530081C03Rik
MMRRC Submission 046034-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.803) question?
Stock # R7993 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 23256895-23440560 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23327622 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1056 (S1056T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180046]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000120747
Gene: ENSMUSG00000056342
AA Change: S1056T

DomainStartEndE-ValueType
low complexity region 489 500 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 591 610 N/A INTRINSIC
coiled coil region 626 671 N/A INTRINSIC
low complexity region 827 842 N/A INTRINSIC
low complexity region 1207 1218 N/A INTRINSIC
low complexity region 1399 1410 N/A INTRINSIC
low complexity region 1518 1532 N/A INTRINSIC
low complexity region 1751 1764 N/A INTRINSIC
low complexity region 1812 1824 N/A INTRINSIC
Pfam:UCH 1950 2293 7.6e-44 PFAM
Pfam:UCH_1 1951 2249 3.6e-22 PFAM
low complexity region 2542 2564 N/A INTRINSIC
low complexity region 2672 2679 N/A INTRINSIC
Blast:Drf_GBD 2943 3116 3e-53 BLAST
low complexity region 3344 3357 N/A INTRINSIC
coiled coil region 3371 3393 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000180046
AA Change: S1037T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137430
Gene: ENSMUSG00000056342
AA Change: S1037T

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 571 590 N/A INTRINSIC
coiled coil region 607 652 N/A INTRINSIC
low complexity region 807 822 N/A INTRINSIC
low complexity region 1187 1198 N/A INTRINSIC
low complexity region 1379 1390 N/A INTRINSIC
low complexity region 1498 1512 N/A INTRINSIC
low complexity region 1731 1744 N/A INTRINSIC
low complexity region 1792 1804 N/A INTRINSIC
Pfam:UCH 1930 2273 2.3e-44 PFAM
Pfam:UCH_1 1931 2229 1.1e-22 PFAM
low complexity region 2522 2544 N/A INTRINSIC
low complexity region 2652 2659 N/A INTRINSIC
Blast:Drf_GBD 2923 3096 2e-53 BLAST
low complexity region 3324 3337 N/A INTRINSIC
coiled coil region 3352 3374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T A 19: 43,803,231 (GRCm39) V689D possibly damaging Het
Adamts17 T C 7: 66,499,612 (GRCm39) V53A possibly damaging Het
Adcy9 T C 16: 4,235,866 (GRCm39) N515S probably damaging Het
Aoc1l3 T A 6: 48,964,542 (GRCm39) N183K possibly damaging Het
Atp1a2 A G 1: 172,118,878 (GRCm39) V88A possibly damaging Het
Atp1a3 T C 7: 24,700,406 (GRCm39) probably null Het
Baz2a T C 10: 127,961,491 (GRCm39) F1706L probably benign Het
Cacnb2 A C 2: 14,968,731 (GRCm39) N199T probably benign Het
Caskin1 T A 17: 24,718,279 (GRCm39) Y296* probably null Het
Cemip C A 7: 83,613,383 (GRCm39) G605V probably damaging Het
Ciart T A 3: 95,786,206 (GRCm39) K290* probably null Het
Cideb G T 14: 55,995,899 (GRCm39) probably benign Het
Copg2 A T 6: 30,793,097 (GRCm39) Y413N probably damaging Het
Csrp1 T A 1: 135,674,453 (GRCm39) probably null Het
Cyp2j8 C T 4: 96,335,456 (GRCm39) probably null Het
Dcbld1 T A 10: 52,137,884 (GRCm39) Y49* probably null Het
Dpep1 T C 8: 123,927,460 (GRCm39) V338A possibly damaging Het
Exoc2 A G 13: 31,090,713 (GRCm39) probably null Het
Fcho2 A T 13: 98,888,524 (GRCm39) probably null Het
Foxd3 C T 4: 99,544,841 (GRCm39) probably benign Het
Gabbr2 C T 4: 46,736,349 (GRCm39) probably null Het
Gipc3 T C 10: 81,173,805 (GRCm39) D269G probably damaging Het
Gm4861 G A 3: 137,256,417 (GRCm39) T63M probably damaging Het
Hmga1b C A 11: 120,653,833 (GRCm39) A40E probably damaging Het
Hydin T A 8: 111,306,264 (GRCm39) M3889K probably benign Het
Inhca T A 9: 103,140,332 (GRCm39) K462N probably benign Het
Klk14 T A 7: 43,344,367 (GRCm39) M226K probably benign Het
Liph T G 16: 21,777,562 (GRCm39) M413L probably benign Het
Lrrc37a T C 11: 103,348,787 (GRCm39) D2636G unknown Het
Lrrk1 G A 7: 65,912,202 (GRCm39) T1786M probably benign Het
Map1a A G 2: 121,135,057 (GRCm39) S1958G possibly damaging Het
Msto1 A G 3: 88,817,481 (GRCm39) F484S probably benign Het
Muc2 C T 7: 141,308,173 (GRCm39) H890Y Het
Nectin3 T C 16: 46,279,184 (GRCm39) I265V probably benign Het
Nectin4 C T 1: 171,211,322 (GRCm39) T282I probably damaging Het
Nfat5 T A 8: 108,082,134 (GRCm39) probably null Het
Nsmaf T C 4: 6,398,647 (GRCm39) D819G probably benign Het
Or8b8 A T 9: 37,808,633 (GRCm39) probably benign Het
Pcdhb1 A T 18: 37,400,044 (GRCm39) D665V probably damaging Het
Pkd1l1 T C 11: 8,895,262 (GRCm39) D616G Het
Plppr2 A T 9: 21,858,258 (GRCm39) H286L probably damaging Het
Polrmt T C 10: 79,572,085 (GRCm39) T1203A probably damaging Het
Ppm1d T A 11: 85,217,777 (GRCm39) V180E probably damaging Het
Ppp1r18 T A 17: 36,184,718 (GRCm39) I551N probably benign Het
Psg28 C T 7: 18,160,401 (GRCm39) C265Y possibly damaging Het
Psmc1 A G 12: 100,081,824 (GRCm39) D142G probably benign Het
Rabgap1l G T 1: 160,528,424 (GRCm39) A394E probably damaging Het
Rbm48 G A 5: 3,640,470 (GRCm39) P303L probably benign Het
Rnf167 T C 11: 70,540,821 (GRCm39) V185A probably benign Het
Ros1 T A 10: 51,999,443 (GRCm39) Q1169L probably benign Het
Rrp1b A G 17: 32,277,541 (GRCm39) D607G probably damaging Het
Scamp1 A G 13: 94,366,294 (GRCm39) Y134H probably damaging Het
Scfd1 G A 12: 51,492,490 (GRCm39) E600K probably damaging Het
Scn3b A G 9: 40,193,840 (GRCm39) E189G possibly damaging Het
Scn4b G T 9: 45,059,007 (GRCm39) V93L probably benign Het
Serpina3i A T 12: 104,231,407 (GRCm39) T15S possibly damaging Het
Slc2a13 A T 15: 91,296,356 (GRCm39) C319* probably null Het
Tdrd1 A G 19: 56,854,437 (GRCm39) probably null Het
Tep1 T A 14: 51,067,710 (GRCm39) I2169F probably benign Het
Tm4sf19 A G 16: 32,226,458 (GRCm39) D124G possibly damaging Het
Trim2 T C 3: 84,098,026 (GRCm39) Y434C probably damaging Het
Vmn1r230 T A 17: 21,067,312 (GRCm39) M167K probably benign Het
Vmn2r14 T A 5: 109,363,862 (GRCm39) M685L probably benign Het
Zfhx4 T A 3: 5,478,047 (GRCm39) V3554D probably damaging Het
Zfp1010 C T 2: 176,957,015 (GRCm39) G161D probably damaging Het
Zfp458 A G 13: 67,405,234 (GRCm39) S402P probably damaging Het
Zfp462 C A 4: 55,011,907 (GRCm39) A1291E probably damaging Het
Zmat5 G A 11: 4,672,379 (GRCm39) probably benign Het
Znfx1 C A 2: 166,897,857 (GRCm39) E356* probably null Het
Zswim5 A G 4: 116,808,291 (GRCm39) T292A probably benign Het
Other mutations in Usp34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL00477:Usp34 APN 11 23,418,879 (GRCm39) missense probably damaging 0.99
IGL01307:Usp34 APN 11 23,367,676 (GRCm39) missense probably damaging 0.99
IGL01313:Usp34 APN 11 23,423,206 (GRCm39) missense probably damaging 1.00
IGL01794:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01826:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01827:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01830:Usp34 APN 11 23,386,020 (GRCm39) missense probably damaging 0.98
IGL01867:Usp34 APN 11 23,334,411 (GRCm39) missense possibly damaging 0.77
IGL01939:Usp34 APN 11 23,295,141 (GRCm39) splice site probably benign
IGL01977:Usp34 APN 11 23,402,661 (GRCm39) missense probably damaging 1.00
IGL01985:Usp34 APN 11 23,402,565 (GRCm39) missense probably damaging 1.00
IGL02011:Usp34 APN 11 23,421,554 (GRCm39) missense probably damaging 0.99
IGL02302:Usp34 APN 11 23,417,243 (GRCm39) missense possibly damaging 0.91
IGL02423:Usp34 APN 11 23,304,900 (GRCm39) missense probably benign 0.11
IGL02491:Usp34 APN 11 23,382,630 (GRCm39) missense probably damaging 0.98
IGL02532:Usp34 APN 11 23,320,291 (GRCm39) missense probably damaging 0.99
IGL02561:Usp34 APN 11 23,301,652 (GRCm39) missense probably benign 0.09
IGL02706:Usp34 APN 11 23,338,659 (GRCm39) splice site probably benign
IGL02891:Usp34 APN 11 23,437,166 (GRCm39) missense probably benign 0.09
IGL03079:Usp34 APN 11 23,382,247 (GRCm39) missense possibly damaging 0.48
IGL03089:Usp34 APN 11 23,396,958 (GRCm39) missense possibly damaging 0.84
IGL03175:Usp34 APN 11 23,438,686 (GRCm39) missense probably benign
IGL03256:Usp34 APN 11 23,370,090 (GRCm39) nonsense probably null
IGL03280:Usp34 APN 11 23,304,897 (GRCm39) missense probably damaging 1.00
IGL03289:Usp34 APN 11 23,343,818 (GRCm39) missense possibly damaging 0.94
IGL03408:Usp34 APN 11 23,396,957 (GRCm39) missense possibly damaging 0.92
Chub UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
Cicione UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R5571_Usp34_680 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5713_Usp34_003 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
Roebuck UTSW 11 23,436,810 (GRCm39) splice site probably benign
stoat UTSW 11 23,437,203 (GRCm39) missense
tunnelvision UTSW 11 23,396,968 (GRCm39) missense
I2288:Usp34 UTSW 11 23,382,473 (GRCm39) splice site probably benign
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0047:Usp34 UTSW 11 23,414,403 (GRCm39) missense probably benign 0.34
R0099:Usp34 UTSW 11 23,313,111 (GRCm39) missense probably damaging 1.00
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0240:Usp34 UTSW 11 23,383,206 (GRCm39) missense probably damaging 0.99
R0403:Usp34 UTSW 11 23,283,838 (GRCm39) missense possibly damaging 0.82
R0432:Usp34 UTSW 11 23,351,505 (GRCm39) missense probably damaging 0.99
R0446:Usp34 UTSW 11 23,417,207 (GRCm39) missense probably damaging 0.97
R0455:Usp34 UTSW 11 23,396,741 (GRCm39) splice site probably benign
R0470:Usp34 UTSW 11 23,386,001 (GRCm39) missense possibly damaging 0.94
R0472:Usp34 UTSW 11 23,334,509 (GRCm39) splice site probably benign
R0512:Usp34 UTSW 11 23,401,997 (GRCm39) missense probably benign 0.04
R0557:Usp34 UTSW 11 23,353,848 (GRCm39) missense probably damaging 0.98
R0562:Usp34 UTSW 11 23,382,406 (GRCm39) splice site probably benign
R0656:Usp34 UTSW 11 23,422,967 (GRCm39) missense probably damaging 0.99
R0693:Usp34 UTSW 11 23,402,637 (GRCm39) missense probably damaging 0.97
R0739:Usp34 UTSW 11 23,417,243 (GRCm39) missense possibly damaging 0.91
R1061:Usp34 UTSW 11 23,334,420 (GRCm39) missense possibly damaging 0.51
R1078:Usp34 UTSW 11 23,383,175 (GRCm39) splice site probably benign
R1223:Usp34 UTSW 11 23,396,464 (GRCm39) splice site probably null
R1295:Usp34 UTSW 11 23,334,477 (GRCm39) missense probably damaging 1.00
R1430:Usp34 UTSW 11 23,409,151 (GRCm39) missense probably damaging 0.97
R1445:Usp34 UTSW 11 23,301,629 (GRCm39) missense probably damaging 0.99
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1468:Usp34 UTSW 11 23,391,171 (GRCm39) missense probably damaging 1.00
R1471:Usp34 UTSW 11 23,438,862 (GRCm39) missense probably benign 0.20
R1475:Usp34 UTSW 11 23,423,253 (GRCm39) missense probably damaging 0.99
R1628:Usp34 UTSW 11 23,438,725 (GRCm39) missense probably damaging 1.00
R1631:Usp34 UTSW 11 23,410,651 (GRCm39) missense probably damaging 0.99
R1655:Usp34 UTSW 11 23,325,051 (GRCm39) missense probably benign 0.05
R1741:Usp34 UTSW 11 23,314,103 (GRCm39) missense probably benign 0.00
R1854:Usp34 UTSW 11 23,376,153 (GRCm39) missense probably benign 0.24
R1867:Usp34 UTSW 11 23,311,593 (GRCm39) missense possibly damaging 0.82
R1869:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1870:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1871:Usp34 UTSW 11 23,314,479 (GRCm39) missense probably benign 0.37
R1967:Usp34 UTSW 11 23,314,503 (GRCm39) missense probably benign 0.01
R2051:Usp34 UTSW 11 23,414,468 (GRCm39) missense probably damaging 0.97
R2132:Usp34 UTSW 11 23,414,556 (GRCm39) missense possibly damaging 0.95
R2156:Usp34 UTSW 11 23,332,602 (GRCm39) missense probably damaging 0.98
R2205:Usp34 UTSW 11 23,335,147 (GRCm39) missense probably damaging 0.97
R2342:Usp34 UTSW 11 23,353,599 (GRCm39) missense possibly damaging 0.46
R3431:Usp34 UTSW 11 23,320,466 (GRCm39) missense possibly damaging 0.95
R3812:Usp34 UTSW 11 23,414,517 (GRCm39) missense possibly damaging 0.94
R3872:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3873:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3874:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3875:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R3925:Usp34 UTSW 11 23,293,640 (GRCm39) missense probably benign 0.28
R3972:Usp34 UTSW 11 23,407,803 (GRCm39) missense probably damaging 1.00
R4018:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4042:Usp34 UTSW 11 23,439,033 (GRCm39) missense possibly damaging 0.85
R4155:Usp34 UTSW 11 23,367,676 (GRCm39) missense probably damaging 0.99
R4197:Usp34 UTSW 11 23,394,189 (GRCm39) missense probably damaging 0.98
R4352:Usp34 UTSW 11 23,270,727 (GRCm39) missense possibly damaging 0.73
R4379:Usp34 UTSW 11 23,334,499 (GRCm39) missense possibly damaging 0.52
R4444:Usp34 UTSW 11 23,385,998 (GRCm39) missense probably damaging 0.98
R4475:Usp34 UTSW 11 23,407,975 (GRCm39) missense possibly damaging 0.95
R4501:Usp34 UTSW 11 23,351,529 (GRCm39) missense probably damaging 1.00
R4527:Usp34 UTSW 11 23,371,257 (GRCm39) missense possibly damaging 0.57
R4603:Usp34 UTSW 11 23,414,633 (GRCm39) missense probably damaging 0.97
R4612:Usp34 UTSW 11 23,382,268 (GRCm39) missense probably damaging 0.99
R4673:Usp34 UTSW 11 23,314,480 (GRCm39) small deletion probably benign
R4707:Usp34 UTSW 11 23,437,215 (GRCm39) missense probably damaging 1.00
R4736:Usp34 UTSW 11 23,343,749 (GRCm39) splice site probably null
R4867:Usp34 UTSW 11 23,401,999 (GRCm39) missense probably benign 0.28
R4879:Usp34 UTSW 11 23,323,410 (GRCm39) missense possibly damaging 0.94
R4977:Usp34 UTSW 11 23,438,982 (GRCm39) missense probably damaging 1.00
R5004:Usp34 UTSW 11 23,414,586 (GRCm39) missense probably damaging 1.00
R5057:Usp34 UTSW 11 23,408,086 (GRCm39) intron probably benign
R5068:Usp34 UTSW 11 23,410,665 (GRCm39) missense possibly damaging 0.94
R5304:Usp34 UTSW 11 23,293,616 (GRCm39) missense probably damaging 1.00
R5320:Usp34 UTSW 11 23,283,739 (GRCm39) missense probably benign
R5327:Usp34 UTSW 11 23,418,846 (GRCm39) missense probably damaging 1.00
R5328:Usp34 UTSW 11 23,438,659 (GRCm39) missense probably benign 0.04
R5328:Usp34 UTSW 11 23,414,616 (GRCm39) missense probably benign 0.01
R5390:Usp34 UTSW 11 23,394,202 (GRCm39) critical splice donor site probably null
R5434:Usp34 UTSW 11 23,362,271 (GRCm39) missense probably damaging 0.99
R5523:Usp34 UTSW 11 23,299,198 (GRCm39) missense probably benign 0.39
R5567:Usp34 UTSW 11 23,438,336 (GRCm39) missense probably damaging 0.97
R5571:Usp34 UTSW 11 23,407,975 (GRCm39) missense probably damaging 0.99
R5645:Usp34 UTSW 11 23,325,024 (GRCm39) missense possibly damaging 0.86
R5713:Usp34 UTSW 11 23,293,515 (GRCm39) missense possibly damaging 0.94
R5719:Usp34 UTSW 11 23,304,846 (GRCm39) missense probably benign 0.00
R5813:Usp34 UTSW 11 23,371,340 (GRCm39) missense probably benign 0.38
R5921:Usp34 UTSW 11 23,414,686 (GRCm39) missense probably damaging 0.99
R5928:Usp34 UTSW 11 23,386,040 (GRCm39) missense probably damaging 0.98
R5944:Usp34 UTSW 11 23,313,089 (GRCm39) missense probably damaging 1.00
R6198:Usp34 UTSW 11 23,434,127 (GRCm39) missense probably damaging 1.00
R6229:Usp34 UTSW 11 23,396,778 (GRCm39) missense probably damaging 0.99
R6306:Usp34 UTSW 11 23,362,260 (GRCm39) missense possibly damaging 0.94
R6320:Usp34 UTSW 11 23,402,520 (GRCm39) missense probably damaging 0.98
R6341:Usp34 UTSW 11 23,331,353 (GRCm39) missense probably damaging 0.97
R6374:Usp34 UTSW 11 23,388,914 (GRCm39) missense probably damaging 1.00
R6398:Usp34 UTSW 11 23,438,666 (GRCm39) missense probably benign
R6438:Usp34 UTSW 11 23,314,266 (GRCm39) missense probably benign 0.02
R6668:Usp34 UTSW 11 23,410,659 (GRCm39) missense probably damaging 0.97
R6700:Usp34 UTSW 11 23,389,011 (GRCm39) missense probably damaging 1.00
R6783:Usp34 UTSW 11 23,362,318 (GRCm39) missense probably damaging 1.00
R6821:Usp34 UTSW 11 23,317,491 (GRCm39) missense possibly damaging 0.79
R6855:Usp34 UTSW 11 23,402,569 (GRCm39) missense possibly damaging 0.94
R6916:Usp34 UTSW 11 23,408,023 (GRCm39) missense probably damaging 0.98
R7020:Usp34 UTSW 11 23,343,954 (GRCm39) missense probably benign 0.05
R7026:Usp34 UTSW 11 23,311,622 (GRCm39) missense probably damaging 1.00
R7085:Usp34 UTSW 11 23,313,097 (GRCm39) missense
R7101:Usp34 UTSW 11 23,376,183 (GRCm39) missense
R7168:Usp34 UTSW 11 23,414,585 (GRCm39) missense
R7192:Usp34 UTSW 11 23,410,571 (GRCm39) missense
R7264:Usp34 UTSW 11 23,283,566 (GRCm39) missense probably benign 0.00
R7325:Usp34 UTSW 11 23,369,052 (GRCm39) missense
R7343:Usp34 UTSW 11 23,438,868 (GRCm39) missense
R7358:Usp34 UTSW 11 23,311,683 (GRCm39) missense probably damaging 0.99
R7369:Usp34 UTSW 11 23,382,361 (GRCm39) missense
R7389:Usp34 UTSW 11 23,295,200 (GRCm39) missense
R7459:Usp34 UTSW 11 23,314,458 (GRCm39) missense possibly damaging 0.53
R7517:Usp34 UTSW 11 23,396,968 (GRCm39) missense
R7729:Usp34 UTSW 11 23,399,268 (GRCm39) missense
R7777:Usp34 UTSW 11 23,332,638 (GRCm39) missense
R7810:Usp34 UTSW 11 23,362,314 (GRCm39) missense
R7836:Usp34 UTSW 11 23,396,614 (GRCm39) missense
R7862:Usp34 UTSW 11 23,414,718 (GRCm39) missense
R8050:Usp34 UTSW 11 23,396,787 (GRCm39) missense
R8054:Usp34 UTSW 11 23,311,295 (GRCm39) missense
R8239:Usp34 UTSW 11 23,396,750 (GRCm39) missense
R8266:Usp34 UTSW 11 23,436,810 (GRCm39) splice site probably benign
R8347:Usp34 UTSW 11 23,362,345 (GRCm39) missense
R8409:Usp34 UTSW 11 23,407,811 (GRCm39) missense
R8692:Usp34 UTSW 11 23,379,325 (GRCm39) missense
R8694:Usp34 UTSW 11 23,434,161 (GRCm39) missense
R8734:Usp34 UTSW 11 23,394,184 (GRCm39) missense
R8806:Usp34 UTSW 11 23,434,143 (GRCm39) missense
R8914:Usp34 UTSW 11 23,293,604 (GRCm39) missense
R8987:Usp34 UTSW 11 23,414,267 (GRCm39) missense
R9013:Usp34 UTSW 11 23,320,302 (GRCm39) missense
R9108:Usp34 UTSW 11 23,320,528 (GRCm39) missense
R9264:Usp34 UTSW 11 23,439,064 (GRCm39) missense
R9301:Usp34 UTSW 11 23,422,951 (GRCm39) missense
R9375:Usp34 UTSW 11 23,437,203 (GRCm39) missense
R9385:Usp34 UTSW 11 23,399,223 (GRCm39) missense
R9500:Usp34 UTSW 11 23,331,337 (GRCm39) missense probably damaging 0.99
R9566:Usp34 UTSW 11 23,317,529 (GRCm39) missense
R9629:Usp34 UTSW 11 23,314,364 (GRCm39) missense
R9679:Usp34 UTSW 11 23,394,369 (GRCm39) missense
R9680:Usp34 UTSW 11 23,317,385 (GRCm39) missense possibly damaging 0.94
R9686:Usp34 UTSW 11 23,424,351 (GRCm39) missense
R9752:Usp34 UTSW 11 23,409,182 (GRCm39) missense probably benign 0.11
X0023:Usp34 UTSW 11 23,325,028 (GRCm39) missense possibly damaging 0.73
X0057:Usp34 UTSW 11 23,407,824 (GRCm39) missense possibly damaging 0.86
Z1176:Usp34 UTSW 11 23,423,221 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAGGCCTTATGAACTGTATGG -3'
(R):5'- GCCACAAAGAGAATTTATCATGGTC -3'

Sequencing Primer
(F):5'- ACAGGATGATTGCCATGAGTTC -3'
(R):5'- CCATGGGGATTTTATTTGAAATGTC -3'
Posted On 2020-09-15