Mutagenetix > Incidental Mutations

Incidental Mutation 'R7993:Exoc2'

651892

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R7993 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 30906730 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000021785 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

PDB Structure

RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000021785

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102946

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

100% (69/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	T	A	9: 103,263,133	K462N	probably benign	Het
Abcc2	T	A	19: 43,814,792	V689D	possibly damaging	Het
Adamts17	T	C	7: 66,849,864	V53A	possibly damaging	Het
Adcy9	T	C	16: 4,418,002	N515S	probably damaging	Het
Atp1a2	A	G	1: 172,291,311	V88A	possibly damaging	Het
Atp1a3	T	C	7: 25,000,981		probably null	Het
Baz2a	T	C	10: 128,125,622	F1706L	probably benign	Het
Cacnb2	A	C	2: 14,963,920	N199T	probably benign	Het
Caskin1	T	A	17: 24,499,305	Y296*	probably null	Het
Cemip	C	A	7: 83,964,175	G605V	probably damaging	Het
Ciart	T	A	3: 95,878,894	K290*	probably null	Het
Cideb	G	T	14: 55,758,442		probably benign	Het
Copg2	A	T	6: 30,816,162	Y413N	probably damaging	Het
Csrp1	T	A	1: 135,746,715		probably null	Het
Cyp2j8	C	T	4: 96,447,219		probably null	Het
Dcbld1	T	A	10: 52,261,788	Y49*	probably null	Het
Dpep1	T	C	8: 123,200,721	V338A	possibly damaging	Het
Fcho2	A	T	13: 98,752,016		probably null	Het
Foxd3	C	T	4: 99,656,604		probably benign	Het
Gabbr2	C	T	4: 46,736,349		probably null	Het
Gipc3	T	C	10: 81,337,971	D269G	probably damaging	Het
Gm14409	C	T	2: 177,265,222	G161D	probably damaging	Het
Gm4861	G	A	3: 137,550,656	T63M	probably damaging	Het
Hmga1b	C	A	11: 120,763,007	A40E	probably damaging	Het
Hydin	T	A	8: 110,579,632	M3889K	probably benign	Het
Klk14	T	A	7: 43,694,943	M226K	probably benign	Het
Liph	T	G	16: 21,958,812	M413L	probably benign	Het
Lrrc37a	T	C	11: 103,457,961	D2636G	unknown	Het
Lrrk1	G	A	7: 66,262,454	T1786M	probably benign	Het
Map1a	A	G	2: 121,304,576	S1958G	possibly damaging	Het
Msto1	A	G	3: 88,910,174	F484S	probably benign	Het
Muc2	C	T	7: 141,754,436	H890Y		Het
Nectin3	T	C	16: 46,458,821	I265V	probably benign	Het
Nectin4	C	T	1: 171,383,754	T282I	probably damaging	Het
Nfat5	T	A	8: 107,355,502		probably null	Het
Nsmaf	T	C	4: 6,398,647	D819G	probably benign	Het
Olfr145	A	T	9: 37,897,337		probably benign	Het
Pcdhb1	A	T	18: 37,266,991	D665V	probably damaging	Het
Pkd1l1	T	C	11: 8,945,262	D616G		Het
Plppr2	A	T	9: 21,946,962	H286L	probably damaging	Het
Polrmt	T	C	10: 79,736,251	T1203A	probably damaging	Het
Ppm1d	T	A	11: 85,326,951	V180E	probably damaging	Het
Ppp1r18	T	A	17: 35,873,826	I551N	probably benign	Het
Psg28	C	T	7: 18,426,476	C265Y	possibly damaging	Het
Psmc1	A	G	12: 100,115,565	D142G	probably benign	Het
Rabgap1l	G	T	1: 160,700,854	A394E	probably damaging	Het
Rbm48	G	A	5: 3,590,470	P303L	probably benign	Het
Rnf167	T	C	11: 70,649,995	V185A	probably benign	Het
Ros1	T	A	10: 52,123,347	Q1169L	probably benign	Het
Rrp1b	A	G	17: 32,058,567	D607G	probably damaging	Het
Scamp1	A	G	13: 94,229,786	Y134H	probably damaging	Het
Scfd1	G	A	12: 51,445,707	E600K	probably damaging	Het
Scn3b	A	G	9: 40,282,544	E189G	possibly damaging	Het
Scn4b	G	T	9: 45,147,709	V93L	probably benign	Het
Serpina3i	A	T	12: 104,265,148	T15S	possibly damaging	Het
Slc2a13	A	T	15: 91,412,153	C319*	probably null	Het
Svs1	T	A	6: 48,987,608	N183K	possibly damaging	Het
Tdrd1	A	G	19: 56,866,005		probably null	Het
Tep1	T	A	14: 50,830,253	I2169F	probably benign	Het
Tm4sf19	A	G	16: 32,407,640	D124G	possibly damaging	Het
Trim2	T	C	3: 84,190,719	Y434C	probably damaging	Het
Usp34	T	A	11: 23,377,622	S1056T		Het
Vmn1r230	T	A	17: 20,847,050	M167K	probably benign	Het
Vmn2r14	T	A	5: 109,215,996	M685L	probably benign	Het
Zfhx4	T	A	3: 5,412,987	V3554D	probably damaging	Het
Zfp458	A	G	13: 67,257,170	S402P	probably damaging	Het
Zfp462	C	A	4: 55,011,907	A1291E	probably damaging	Het
Zmat5	G	A	11: 4,722,379		probably benign	Het
Znfx1	C	A	2: 167,055,937	E356*	probably null	Het
Zswim5	A	G	4: 116,951,094	T292A	probably benign	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5410:Exoc2	UTSW	13	30864856	missense	probably damaging	0.98
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCGTTTTCCCAAAGAGCGATTTG -3'
(R):5'- AGACTCAGGTCACTGTCACC -3'

Sequencing Primer
(F):5'- CAAAGAGCGATTTGGCTTTTTC -3'
(R):5'- AGGTCACTGTCACCCACCTTC -3'

Posted On

2020-09-15