Incidental Mutation 'R7993:Exoc2'
ID 651892
Institutional Source Beutler Lab
Gene Symbol Exoc2
Ensembl Gene ENSMUSG00000021357
Gene Name exocyst complex component 2
Synonyms 2410030I24Rik, Sec5l1, Sec5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock # R7993 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 30813919-30974093 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 30906730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]
AlphaFold Q9D4H1
PDB Structure RAL BINDING DOMAIN FROM SEC5 [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000021785
SMART Domains Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 3.2e-10 PFAM
Pfam:Sec5 198 377 3.6e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102946
SMART Domains Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357

DomainStartEndE-ValueType
Pfam:TIG 8 92 2.5e-10 PFAM
Pfam:Sec5 198 377 7.5e-59 PFAM
low complexity region 572 585 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,263,133 K462N probably benign Het
Abcc2 T A 19: 43,814,792 V689D possibly damaging Het
Adamts17 T C 7: 66,849,864 V53A possibly damaging Het
Adcy9 T C 16: 4,418,002 N515S probably damaging Het
Atp1a2 A G 1: 172,291,311 V88A possibly damaging Het
Atp1a3 T C 7: 25,000,981 probably null Het
Baz2a T C 10: 128,125,622 F1706L probably benign Het
Cacnb2 A C 2: 14,963,920 N199T probably benign Het
Caskin1 T A 17: 24,499,305 Y296* probably null Het
Cemip C A 7: 83,964,175 G605V probably damaging Het
Ciart T A 3: 95,878,894 K290* probably null Het
Cideb G T 14: 55,758,442 probably benign Het
Copg2 A T 6: 30,816,162 Y413N probably damaging Het
Csrp1 T A 1: 135,746,715 probably null Het
Cyp2j8 C T 4: 96,447,219 probably null Het
Dcbld1 T A 10: 52,261,788 Y49* probably null Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
Fcho2 A T 13: 98,752,016 probably null Het
Foxd3 C T 4: 99,656,604 probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gipc3 T C 10: 81,337,971 D269G probably damaging Het
Gm14409 C T 2: 177,265,222 G161D probably damaging Het
Gm4861 G A 3: 137,550,656 T63M probably damaging Het
Hmga1b C A 11: 120,763,007 A40E probably damaging Het
Hydin T A 8: 110,579,632 M3889K probably benign Het
Klk14 T A 7: 43,694,943 M226K probably benign Het
Liph T G 16: 21,958,812 M413L probably benign Het
Lrrc37a T C 11: 103,457,961 D2636G unknown Het
Lrrk1 G A 7: 66,262,454 T1786M probably benign Het
Map1a A G 2: 121,304,576 S1958G possibly damaging Het
Msto1 A G 3: 88,910,174 F484S probably benign Het
Muc2 C T 7: 141,754,436 H890Y Het
Nectin3 T C 16: 46,458,821 I265V probably benign Het
Nectin4 C T 1: 171,383,754 T282I probably damaging Het
Nfat5 T A 8: 107,355,502 probably null Het
Nsmaf T C 4: 6,398,647 D819G probably benign Het
Olfr145 A T 9: 37,897,337 probably benign Het
Pcdhb1 A T 18: 37,266,991 D665V probably damaging Het
Pkd1l1 T C 11: 8,945,262 D616G Het
Plppr2 A T 9: 21,946,962 H286L probably damaging Het
Polrmt T C 10: 79,736,251 T1203A probably damaging Het
Ppm1d T A 11: 85,326,951 V180E probably damaging Het
Ppp1r18 T A 17: 35,873,826 I551N probably benign Het
Psg28 C T 7: 18,426,476 C265Y possibly damaging Het
Psmc1 A G 12: 100,115,565 D142G probably benign Het
Rabgap1l G T 1: 160,700,854 A394E probably damaging Het
Rbm48 G A 5: 3,590,470 P303L probably benign Het
Rnf167 T C 11: 70,649,995 V185A probably benign Het
Ros1 T A 10: 52,123,347 Q1169L probably benign Het
Rrp1b A G 17: 32,058,567 D607G probably damaging Het
Scamp1 A G 13: 94,229,786 Y134H probably damaging Het
Scfd1 G A 12: 51,445,707 E600K probably damaging Het
Scn3b A G 9: 40,282,544 E189G possibly damaging Het
Scn4b G T 9: 45,147,709 V93L probably benign Het
Serpina3i A T 12: 104,265,148 T15S possibly damaging Het
Slc2a13 A T 15: 91,412,153 C319* probably null Het
Svs1 T A 6: 48,987,608 N183K possibly damaging Het
Tdrd1 A G 19: 56,866,005 probably null Het
Tep1 T A 14: 50,830,253 I2169F probably benign Het
Tm4sf19 A G 16: 32,407,640 D124G possibly damaging Het
Trim2 T C 3: 84,190,719 Y434C probably damaging Het
Usp34 T A 11: 23,377,622 S1056T Het
Vmn1r230 T A 17: 20,847,050 M167K probably benign Het
Vmn2r14 T A 5: 109,215,996 M685L probably benign Het
Zfhx4 T A 3: 5,412,987 V3554D probably damaging Het
Zfp458 A G 13: 67,257,170 S402P probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zmat5 G A 11: 4,722,379 probably benign Het
Znfx1 C A 2: 167,055,937 E356* probably null Het
Zswim5 A G 4: 116,951,094 T292A probably benign Het
Other mutations in Exoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Exoc2 APN 13 30820626 missense probably benign 0.17
IGL01839:Exoc2 APN 13 30906799 missense probably damaging 1.00
IGL02092:Exoc2 APN 13 30875277 missense probably benign 0.09
IGL02245:Exoc2 APN 13 30906859 missense probably benign 0.10
IGL02267:Exoc2 APN 13 30815321 missense probably benign
IGL02478:Exoc2 APN 13 30927420 missense probably benign
IGL02500:Exoc2 APN 13 30911196 missense probably damaging 1.00
IGL03081:Exoc2 APN 13 30900902 missense probably benign 0.28
IGL03112:Exoc2 APN 13 30906587 splice site probably benign
IGL03409:Exoc2 APN 13 30940737 utr 5 prime probably benign
R0284:Exoc2 UTSW 13 30877625 splice site probably benign
R0452:Exoc2 UTSW 13 30886327 splice site probably benign
R0826:Exoc2 UTSW 13 30856797 critical splice acceptor site probably null
R1251:Exoc2 UTSW 13 30886276 missense probably benign 0.03
R1367:Exoc2 UTSW 13 30882273 nonsense probably null
R1501:Exoc2 UTSW 13 30935502 missense probably benign 0.01
R1593:Exoc2 UTSW 13 30856761 missense possibly damaging 0.64
R1839:Exoc2 UTSW 13 30906497 splice site probably benign
R1872:Exoc2 UTSW 13 30822661 missense probably benign 0.17
R2064:Exoc2 UTSW 13 30935561 missense probably benign 0.00
R2070:Exoc2 UTSW 13 30815370 missense probably benign 0.00
R2227:Exoc2 UTSW 13 30864884 missense probably benign
R2507:Exoc2 UTSW 13 30882365 missense possibly damaging 0.55
R3965:Exoc2 UTSW 13 30877582 missense probably benign 0.00
R4601:Exoc2 UTSW 13 30882268 missense probably benign 0.05
R4914:Exoc2 UTSW 13 30876813 missense probably benign 0.21
R5299:Exoc2 UTSW 13 30871918 splice site probably null
R5410:Exoc2 UTSW 13 30864856 missense probably damaging 0.98
R5461:Exoc2 UTSW 13 30925755 missense possibly damaging 0.66
R5956:Exoc2 UTSW 13 30820623 missense probably benign 0.03
R6056:Exoc2 UTSW 13 30900829 missense probably benign 0.03
R6107:Exoc2 UTSW 13 30876797 missense probably benign
R6548:Exoc2 UTSW 13 30826064 missense possibly damaging 0.86
R6692:Exoc2 UTSW 13 30935507 missense probably benign 0.09
R6969:Exoc2 UTSW 13 30911178 missense probably benign
R7386:Exoc2 UTSW 13 30906663 splice site probably null
R7461:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7467:Exoc2 UTSW 13 30925733 missense probably damaging 0.98
R7473:Exoc2 UTSW 13 30822630 critical splice donor site probably null
R7613:Exoc2 UTSW 13 30882272 missense probably benign 0.32
R7767:Exoc2 UTSW 13 30876769 missense probably benign 0.01
R7793:Exoc2 UTSW 13 30911178 missense probably benign 0.00
R7795:Exoc2 UTSW 13 30876773 nonsense probably null
R8085:Exoc2 UTSW 13 30940703 missense probably damaging 1.00
R8330:Exoc2 UTSW 13 30877573 missense probably benign
R8716:Exoc2 UTSW 13 30911244 missense probably damaging 1.00
R8735:Exoc2 UTSW 13 30906839 missense probably damaging 1.00
R8922:Exoc2 UTSW 13 30871855 missense probably benign 0.05
R9237:Exoc2 UTSW 13 30864875 missense probably benign
R9243:Exoc2 UTSW 13 30925795 missense probably benign 0.03
R9365:Exoc2 UTSW 13 30856714 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGTTTTCCCAAAGAGCGATTTG -3'
(R):5'- AGACTCAGGTCACTGTCACC -3'

Sequencing Primer
(F):5'- CAAAGAGCGATTTGGCTTTTTC -3'
(R):5'- AGGTCACTGTCACCCACCTTC -3'
Posted On 2020-09-15