Incidental Mutation 'R7993:Zfp458'
ID651893
Institutional Source Beutler Lab
Gene Symbol Zfp458
Ensembl Gene ENSMUSG00000055480
Gene Namezinc finger protein 458
SynonymsRslcan-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7993 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location67254918-67278466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67257170 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 402 (S402P)
Ref Sequence ENSEMBL: ENSMUSP00000047222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045969] [ENSMUST00000223990] [ENSMUST00000225772]
Predicted Effect probably damaging
Transcript: ENSMUST00000045969
AA Change: S402P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047222
Gene: ENSMUSG00000055480
AA Change: S402P

DomainStartEndE-ValueType
KRAB 5 65 5.27e-32 SMART
ZnF_C2H2 81 103 2.09e-3 SMART
ZnF_C2H2 109 131 1.03e-2 SMART
ZnF_C2H2 137 159 4.11e-2 SMART
ZnF_C2H2 193 215 2.17e1 SMART
ZnF_C2H2 221 243 2.95e-3 SMART
ZnF_C2H2 249 271 7.9e-4 SMART
ZnF_C2H2 277 299 6.32e-3 SMART
ZnF_C2H2 305 327 3.52e-1 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.63e-3 SMART
ZnF_C2H2 389 411 1.2e-3 SMART
ZnF_C2H2 417 439 3.52e-1 SMART
ZnF_C2H2 445 467 4.87e-4 SMART
ZnF_C2H2 473 495 7.26e-3 SMART
ZnF_C2H2 501 523 1.18e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.05e-2 SMART
ZnF_C2H2 585 607 7.78e-3 SMART
ZnF_C2H2 641 663 1.76e-1 SMART
ZnF_C2H2 669 691 5.21e-4 SMART
ZnF_C2H2 697 719 5.14e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223990
Predicted Effect probably damaging
Transcript: ENSMUST00000225772
AA Change: S399P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the C2H2-type zinc finger gene family. The zinc finger proteins are involved in gene regulation and development, and are quite conserved throughout evolution. Like this gene product, a third of the zinc finger proteins containing C2H2 fingers also contain the KRAB domain, which has been found to be involved in protein-protein interactions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,263,133 K462N probably benign Het
Abcc2 T A 19: 43,814,792 V689D possibly damaging Het
Adamts17 T C 7: 66,849,864 V53A possibly damaging Het
Adcy9 T C 16: 4,418,002 N515S probably damaging Het
Atp1a2 A G 1: 172,291,311 V88A possibly damaging Het
Atp1a3 T C 7: 25,000,981 probably null Het
Baz2a T C 10: 128,125,622 F1706L probably benign Het
Cacnb2 A C 2: 14,963,920 N199T probably benign Het
Caskin1 T A 17: 24,499,305 Y296* probably null Het
Cemip C A 7: 83,964,175 G605V probably damaging Het
Ciart T A 3: 95,878,894 K290* probably null Het
Cideb G T 14: 55,758,442 probably benign Het
Copg2 A T 6: 30,816,162 Y413N probably damaging Het
Cyp2j8 C T 4: 96,447,219 probably null Het
Dcbld1 T A 10: 52,261,788 Y49* probably null Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
Exoc2 A G 13: 30,906,730 probably null Het
Foxd3 C T 4: 99,656,604 probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gipc3 T C 10: 81,337,971 D269G probably damaging Het
Gm14409 C T 2: 177,265,222 G161D probably damaging Het
Gm4861 G A 3: 137,550,656 T63M probably damaging Het
Hmga1b C A 11: 120,763,007 A40E probably damaging Het
Hydin T A 8: 110,579,632 M3889K probably benign Het
Klk14 T A 7: 43,694,943 M226K probably benign Het
Liph T G 16: 21,958,812 M413L probably benign Het
Lrrc37a T C 11: 103,457,961 D2636G unknown Het
Lrrk1 G A 7: 66,262,454 T1786M probably benign Het
Map1a A G 2: 121,304,576 S1958G possibly damaging Het
Msto1 A G 3: 88,910,174 F484S probably benign Het
Muc2 C T 7: 141,754,436 H890Y Het
Nectin3 T C 16: 46,458,821 I265V probably benign Het
Nectin4 C T 1: 171,383,754 T282I probably damaging Het
Nsmaf T C 4: 6,398,647 D819G probably benign Het
Olfr145 A T 9: 37,897,337 probably benign Het
Pcdhb1 A T 18: 37,266,991 D665V probably damaging Het
Pkd1l1 T C 11: 8,945,262 D616G Het
Plppr2 A T 9: 21,946,962 H286L probably damaging Het
Polrmt T C 10: 79,736,251 T1203A probably damaging Het
Ppm1d T A 11: 85,326,951 V180E probably damaging Het
Ppp1r18 T A 17: 35,873,826 I551N probably benign Het
Psg28 C T 7: 18,426,476 C265Y possibly damaging Het
Psmc1 A G 12: 100,115,565 D142G probably benign Het
Rabgap1l G T 1: 160,700,854 A394E probably damaging Het
Rbm48 G A 5: 3,590,470 P303L probably benign Het
Rnf167 T C 11: 70,649,995 V185A probably benign Het
Ros1 T A 10: 52,123,347 Q1169L probably benign Het
Rrp1b A G 17: 32,058,567 D607G probably damaging Het
Scamp1 A G 13: 94,229,786 Y134H probably damaging Het
Scfd1 G A 12: 51,445,707 E600K probably damaging Het
Scn3b A G 9: 40,282,544 E189G possibly damaging Het
Scn4b G T 9: 45,147,709 V93L probably benign Het
Serpina3i A T 12: 104,265,148 T15S possibly damaging Het
Slc2a13 A T 15: 91,412,153 C319* probably null Het
Svs1 T A 6: 48,987,608 N183K possibly damaging Het
Tep1 T A 14: 50,830,253 I2169F probably benign Het
Tm4sf19 A G 16: 32,407,640 D124G possibly damaging Het
Trim2 T C 3: 84,190,719 Y434C probably damaging Het
Usp34 T A 11: 23,377,622 S1056T Het
Vmn1r230 T A 17: 20,847,050 M167K probably benign Het
Vmn2r14 T A 5: 109,215,996 M685L probably benign Het
Zfhx4 T A 3: 5,412,987 V3554D probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zmat5 G A 11: 4,722,379 probably benign Het
Znfx1 C A 2: 167,055,937 E356* probably null Het
Zswim5 A G 4: 116,951,094 T292A probably benign Het
Other mutations in Zfp458
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Zfp458 APN 13 67257236 missense probably benign 0.01
IGL01989:Zfp458 APN 13 67259627 missense probably damaging 0.98
IGL02168:Zfp458 APN 13 67258034 missense probably damaging 0.98
IGL02620:Zfp458 APN 13 67257994 missense probably damaging 1.00
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0014:Zfp458 UTSW 13 67258090 missense possibly damaging 0.71
R0025:Zfp458 UTSW 13 67257898 missense probably damaging 0.98
R0066:Zfp458 UTSW 13 67259609 nonsense probably null
R0257:Zfp458 UTSW 13 67259642 nonsense probably null
R1218:Zfp458 UTSW 13 67256209 missense probably damaging 0.99
R1292:Zfp458 UTSW 13 67256690 missense probably damaging 1.00
R1490:Zfp458 UTSW 13 67257509 missense probably damaging 1.00
R1664:Zfp458 UTSW 13 67258080 missense possibly damaging 0.95
R2169:Zfp458 UTSW 13 67257049 missense probably damaging 1.00
R3769:Zfp458 UTSW 13 67257482 missense probably damaging 1.00
R5305:Zfp458 UTSW 13 67256318 missense probably benign 0.31
R5364:Zfp458 UTSW 13 67257948 nonsense probably null
R5426:Zfp458 UTSW 13 67257192 nonsense probably null
R5760:Zfp458 UTSW 13 67257789 missense probably damaging 1.00
R6151:Zfp458 UTSW 13 67257598 missense possibly damaging 0.95
R6186:Zfp458 UTSW 13 67257637 missense probably damaging 1.00
R6298:Zfp458 UTSW 13 67256806 missense probably damaging 1.00
R7368:Zfp458 UTSW 13 67257236 missense probably benign 0.01
R7483:Zfp458 UTSW 13 67256914 missense possibly damaging 0.94
R7711:Zfp458 UTSW 13 67259600 missense possibly damaging 0.95
R7921:Zfp458 UTSW 13 67256116 makesense probably null
R8240:Zfp458 UTSW 13 67258126 missense probably damaging 1.00
R8429:Zfp458 UTSW 13 67258088 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TTCCACATACTTCACACTTGTATGG -3'
(R):5'- AAGTTTGTGGCAAGACCTTCCATT -3'

Sequencing Primer
(F):5'- TTTGGAAAGTCTTGATGGAGAACC -3'
(R):5'- GGCAAGGCCTTCTATTATCCATCAAG -3'
Posted On2020-09-15