Incidental Mutation 'R7993:Tep1'
ID651895
Institutional Source Beutler Lab
Gene Symbol Tep1
Ensembl Gene ENSMUSG00000006281
Gene Nametelomerase associated protein 1
SynonymsTp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7993 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50824059-50870560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50830253 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2169 (I2169F)
Ref Sequence ENSEMBL: ENSMUSP00000006444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006444] [ENSMUST00000227526]
Predicted Effect probably benign
Transcript: ENSMUST00000006444
AA Change: I2169F

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000006444
Gene: ENSMUSG00000006281
AA Change: I2169F

DomainStartEndE-ValueType
Pfam:TEP1_N 1 29 2.8e-20 PFAM
Pfam:TEP1_N 31 59 1.4e-20 PFAM
Pfam:TEP1_N 61 89 3.1e-20 PFAM
Pfam:TEP1_N 91 119 3e-20 PFAM
low complexity region 195 207 N/A INTRINSIC
low complexity region 211 229 N/A INTRINSIC
Pfam:TROVE 230 685 3.2e-136 PFAM
Pfam:DUF4062 909 1020 2.4e-22 PFAM
Pfam:NACHT 1171 1346 9.2e-38 PFAM
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1622 1641 N/A INTRINSIC
WD40 1673 1711 2.98e-1 SMART
WD40 1714 1752 5.33e0 SMART
WD40 1755 1794 1.52e-4 SMART
WD40 1797 1835 3.27e-4 SMART
WD40 1838 1877 3.09e-1 SMART
WD40 1880 1919 2.24e-2 SMART
WD40 1925 1962 4.95e0 SMART
WD40 1968 2003 2.29e1 SMART
WD40 2008 2045 1.72e0 SMART
WD40 2058 2097 3.89e-11 SMART
WD40 2103 2142 3.93e-7 SMART
WD40 2145 2182 4.38e-5 SMART
WD40 2184 2232 1.24e0 SMART
WD40 2235 2273 1.14e-3 SMART
WD40 2275 2315 4.46e-1 SMART
Blast:WD40 2316 2353 4e-12 BLAST
WD40 2546 2583 6.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226430
Predicted Effect probably benign
Transcript: ENSMUST00000227526
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a component of the ribonucleoprotein complex responsible for telomerase activity which catalyzes the addition of new telomeres on the chromosome ends. The telomerase-associated proteins are conserved from ciliates to humans. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a disruption in this gene show no obvious phenotype. No changes are seen in telomerase activity or telomere length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,263,133 K462N probably benign Het
Abcc2 T A 19: 43,814,792 V689D possibly damaging Het
Adamts17 T C 7: 66,849,864 V53A possibly damaging Het
Adcy9 T C 16: 4,418,002 N515S probably damaging Het
Atp1a2 A G 1: 172,291,311 V88A possibly damaging Het
Atp1a3 T C 7: 25,000,981 probably null Het
Baz2a T C 10: 128,125,622 F1706L probably benign Het
Cacnb2 A C 2: 14,963,920 N199T probably benign Het
Caskin1 T A 17: 24,499,305 Y296* probably null Het
Cemip C A 7: 83,964,175 G605V probably damaging Het
Ciart T A 3: 95,878,894 K290* probably null Het
Cideb G T 14: 55,758,442 probably benign Het
Copg2 A T 6: 30,816,162 Y413N probably damaging Het
Cyp2j8 C T 4: 96,447,219 probably null Het
Dcbld1 T A 10: 52,261,788 Y49* probably null Het
Dpep1 T C 8: 123,200,721 V338A possibly damaging Het
Exoc2 A G 13: 30,906,730 probably null Het
Foxd3 C T 4: 99,656,604 probably benign Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gipc3 T C 10: 81,337,971 D269G probably damaging Het
Gm14409 C T 2: 177,265,222 G161D probably damaging Het
Gm4861 G A 3: 137,550,656 T63M probably damaging Het
Hmga1b C A 11: 120,763,007 A40E probably damaging Het
Hydin T A 8: 110,579,632 M3889K probably benign Het
Klk14 T A 7: 43,694,943 M226K probably benign Het
Liph T G 16: 21,958,812 M413L probably benign Het
Lrrc37a T C 11: 103,457,961 D2636G unknown Het
Lrrk1 G A 7: 66,262,454 T1786M probably benign Het
Map1a A G 2: 121,304,576 S1958G possibly damaging Het
Msto1 A G 3: 88,910,174 F484S probably benign Het
Muc2 C T 7: 141,754,436 H890Y Het
Nectin3 T C 16: 46,458,821 I265V probably benign Het
Nectin4 C T 1: 171,383,754 T282I probably damaging Het
Nsmaf T C 4: 6,398,647 D819G probably benign Het
Olfr145 A T 9: 37,897,337 probably benign Het
Pcdhb1 A T 18: 37,266,991 D665V probably damaging Het
Pkd1l1 T C 11: 8,945,262 D616G Het
Plppr2 A T 9: 21,946,962 H286L probably damaging Het
Polrmt T C 10: 79,736,251 T1203A probably damaging Het
Ppm1d T A 11: 85,326,951 V180E probably damaging Het
Ppp1r18 T A 17: 35,873,826 I551N probably benign Het
Psg28 C T 7: 18,426,476 C265Y possibly damaging Het
Psmc1 A G 12: 100,115,565 D142G probably benign Het
Rabgap1l G T 1: 160,700,854 A394E probably damaging Het
Rbm48 G A 5: 3,590,470 P303L probably benign Het
Rnf167 T C 11: 70,649,995 V185A probably benign Het
Ros1 T A 10: 52,123,347 Q1169L probably benign Het
Rrp1b A G 17: 32,058,567 D607G probably damaging Het
Scamp1 A G 13: 94,229,786 Y134H probably damaging Het
Scfd1 G A 12: 51,445,707 E600K probably damaging Het
Scn3b A G 9: 40,282,544 E189G possibly damaging Het
Scn4b G T 9: 45,147,709 V93L probably benign Het
Serpina3i A T 12: 104,265,148 T15S possibly damaging Het
Slc2a13 A T 15: 91,412,153 C319* probably null Het
Svs1 T A 6: 48,987,608 N183K possibly damaging Het
Tm4sf19 A G 16: 32,407,640 D124G possibly damaging Het
Trim2 T C 3: 84,190,719 Y434C probably damaging Het
Usp34 T A 11: 23,377,622 S1056T Het
Vmn1r230 T A 17: 20,847,050 M167K probably benign Het
Vmn2r14 T A 5: 109,215,996 M685L probably benign Het
Zfhx4 T A 3: 5,412,987 V3554D probably damaging Het
Zfp458 A G 13: 67,257,170 S402P probably damaging Het
Zfp462 C A 4: 55,011,907 A1291E probably damaging Het
Zmat5 G A 11: 4,722,379 probably benign Het
Znfx1 C A 2: 167,055,937 E356* probably null Het
Zswim5 A G 4: 116,951,094 T292A probably benign Het
Other mutations in Tep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Tep1 APN 14 50843184 missense probably damaging 1.00
IGL00490:Tep1 APN 14 50833473 missense probably damaging 0.97
IGL01114:Tep1 APN 14 50850639 missense probably damaging 0.98
IGL01294:Tep1 APN 14 50829657 splice site probably benign
IGL01902:Tep1 APN 14 50866091 splice site probably benign
IGL01910:Tep1 APN 14 50844112 missense probably benign 0.06
IGL01925:Tep1 APN 14 50824498 unclassified probably benign
IGL01965:Tep1 APN 14 50863495 splice site probably benign
IGL02071:Tep1 APN 14 50834049 missense possibly damaging 0.93
IGL02124:Tep1 APN 14 50854124 unclassified probably benign
IGL02189:Tep1 APN 14 50826826 missense probably benign
IGL02252:Tep1 APN 14 50830255 missense possibly damaging 0.93
IGL02299:Tep1 APN 14 50840671 missense probably damaging 0.99
IGL02343:Tep1 APN 14 50829247 missense probably damaging 0.99
IGL02423:Tep1 APN 14 50844620 missense possibly damaging 0.53
IGL02537:Tep1 APN 14 50836113 missense probably damaging 0.96
IGL02601:Tep1 APN 14 50833478 nonsense probably null
IGL02941:Tep1 APN 14 50866037 missense probably damaging 0.98
IGL02990:Tep1 APN 14 50868246 missense possibly damaging 0.86
IGL03144:Tep1 APN 14 50844017 splice site probably benign
IGL03209:Tep1 APN 14 50840703 splice site probably benign
PIT4305001:Tep1 UTSW 14 50829227 missense possibly damaging 0.90
PIT4362001:Tep1 UTSW 14 50866053 missense probably benign 0.23
R0058:Tep1 UTSW 14 50834065 missense possibly damaging 0.85
R0060:Tep1 UTSW 14 50866029 missense probably damaging 1.00
R0109:Tep1 UTSW 14 50851916 splice site probably null
R0123:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0134:Tep1 UTSW 14 50829693 missense possibly damaging 0.84
R0148:Tep1 UTSW 14 50824789 missense possibly damaging 0.70
R0240:Tep1 UTSW 14 50863029 splice site probably benign
R0243:Tep1 UTSW 14 50846987 missense probably damaging 1.00
R0373:Tep1 UTSW 14 50836768 missense possibly damaging 0.85
R0432:Tep1 UTSW 14 50866823 small deletion probably benign
R0464:Tep1 UTSW 14 50847684 missense probably benign 0.00
R0566:Tep1 UTSW 14 50845414 critical splice donor site probably null
R0691:Tep1 UTSW 14 50866844 nonsense probably null
R0787:Tep1 UTSW 14 50829230 missense possibly damaging 0.85
R0972:Tep1 UTSW 14 50824296 unclassified probably benign
R1263:Tep1 UTSW 14 50845513 missense possibly damaging 0.84
R1300:Tep1 UTSW 14 50827055 critical splice donor site probably null
R1327:Tep1 UTSW 14 50853099 missense probably benign 0.18
R1556:Tep1 UTSW 14 50853042 missense probably benign 0.06
R1584:Tep1 UTSW 14 50866037 missense probably damaging 0.98
R1607:Tep1 UTSW 14 50824563 missense probably null 0.99
R1686:Tep1 UTSW 14 50836788 missense probably benign 0.12
R1715:Tep1 UTSW 14 50854567 missense possibly damaging 0.92
R1778:Tep1 UTSW 14 50829622 intron probably benign
R1993:Tep1 UTSW 14 50824184 missense possibly damaging 0.93
R2071:Tep1 UTSW 14 50854282 missense probably benign 0.23
R2104:Tep1 UTSW 14 50850580 splice site probably benign
R2118:Tep1 UTSW 14 50855572 splice site probably null
R2119:Tep1 UTSW 14 50838986 missense probably benign 0.13
R2208:Tep1 UTSW 14 50866864 missense probably benign 0.01
R2241:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2243:Tep1 UTSW 14 50854210 missense probably benign 0.01
R2311:Tep1 UTSW 14 50833567 missense possibly damaging 0.95
R2420:Tep1 UTSW 14 50834023 missense probably benign
R2874:Tep1 UTSW 14 50850650 missense possibly damaging 0.71
R3084:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3086:Tep1 UTSW 14 50827054 critical splice donor site probably null
R3621:Tep1 UTSW 14 50829020 missense probably damaging 0.99
R3815:Tep1 UTSW 14 50868315 missense possibly damaging 0.71
R4124:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4125:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4127:Tep1 UTSW 14 50843734 missense possibly damaging 0.93
R4134:Tep1 UTSW 14 50844860 missense probably benign
R4152:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4153:Tep1 UTSW 14 50837594 missense possibly damaging 0.72
R4191:Tep1 UTSW 14 50836806 missense probably damaging 0.96
R4248:Tep1 UTSW 14 50862894 missense possibly damaging 0.93
R4293:Tep1 UTSW 14 50846861 missense probably benign
R4569:Tep1 UTSW 14 50824740 missense probably benign 0.01
R4704:Tep1 UTSW 14 50837073 missense probably benign 0.06
R4815:Tep1 UTSW 14 50841302 missense probably damaging 0.99
R4978:Tep1 UTSW 14 50845434 missense possibly damaging 0.93
R4989:Tep1 UTSW 14 50839000 missense probably benign
R5022:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5057:Tep1 UTSW 14 50828999 missense probably benign 0.27
R5063:Tep1 UTSW 14 50850627 missense possibly damaging 0.86
R5118:Tep1 UTSW 14 50855587 splice site probably null
R5128:Tep1 UTSW 14 50844279 makesense probably null
R5149:Tep1 UTSW 14 50837398 nonsense probably null
R5171:Tep1 UTSW 14 50824802 missense probably benign 0.01
R5201:Tep1 UTSW 14 50868110 missense probably benign 0.01
R5260:Tep1 UTSW 14 50838631 missense probably benign
R5339:Tep1 UTSW 14 50844574 missense probably damaging 0.99
R5384:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5385:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5386:Tep1 UTSW 14 50868317 missense probably damaging 0.98
R5594:Tep1 UTSW 14 50829882 missense possibly damaging 0.86
R5639:Tep1 UTSW 14 50853605 missense possibly damaging 0.85
R5749:Tep1 UTSW 14 50844072 missense possibly damaging 0.59
R5756:Tep1 UTSW 14 50837379 critical splice donor site probably null
R6013:Tep1 UTSW 14 50861048 missense probably damaging 0.97
R6014:Tep1 UTSW 14 50847000 missense probably benign 0.12
R6248:Tep1 UTSW 14 50830258 missense probably damaging 0.98
R6264:Tep1 UTSW 14 50845513 missense probably damaging 0.99
R6363:Tep1 UTSW 14 50824548 missense probably benign 0.04
R6381:Tep1 UTSW 14 50845431 missense probably damaging 0.99
R6462:Tep1 UTSW 14 50844379 missense probably benign
R6942:Tep1 UTSW 14 50836737 missense possibly damaging 0.85
R6951:Tep1 UTSW 14 50833913 critical splice donor site probably null
R6979:Tep1 UTSW 14 50838637 missense possibly damaging 0.93
R6999:Tep1 UTSW 14 50850705 missense possibly damaging 0.86
R7099:Tep1 UTSW 14 50844487 splice site probably null
R7208:Tep1 UTSW 14 50824556 critical splice acceptor site probably null
R7232:Tep1 UTSW 14 50844332 missense unknown
R7249:Tep1 UTSW 14 50824275 missense possibly damaging 0.86
R7325:Tep1 UTSW 14 50866038 missense probably damaging 0.99
R7409:Tep1 UTSW 14 50866855 missense possibly damaging 0.67
R7499:Tep1 UTSW 14 50853590 missense probably damaging 0.99
R7542:Tep1 UTSW 14 50862491 nonsense probably null
R7806:Tep1 UTSW 14 50836809 missense possibly damaging 0.85
R7825:Tep1 UTSW 14 50843887 critical splice acceptor site probably null
R7901:Tep1 UTSW 14 50826851 missense possibly damaging 0.88
R7961:Tep1 UTSW 14 50824230 missense possibly damaging 0.93
R8009:Tep1 UTSW 14 50824230 missense possibly damaging 0.93
R8085:Tep1 UTSW 14 50829296 missense probably benign 0.11
R8299:Tep1 UTSW 14 50868045 missense probably benign 0.06
R8330:Tep1 UTSW 14 50847705 missense possibly damaging 0.86
R8396:Tep1 UTSW 14 50837072 missense probably benign 0.23
RF007:Tep1 UTSW 14 50860945 missense possibly damaging 0.92
X0024:Tep1 UTSW 14 50827119 missense possibly damaging 0.86
X0060:Tep1 UTSW 14 50836764 missense probably benign 0.25
Z1177:Tep1 UTSW 14 50847765 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGGCCCAATGTCAAAGGC -3'
(R):5'- TACAGGTCAAGGTCTCAGGC -3'

Sequencing Primer
(F):5'- AGCACCAGTCCTAGGTTTAATC -3'
(R):5'- TCTCAGGCTGCCAGGAGAAG -3'
Posted On2020-09-15