Incidental Mutation 'R7994:Syt2'
ID651912
Institutional Source Beutler Lab
Gene Symbol Syt2
Ensembl Gene ENSMUSG00000026452
Gene Namesynaptotagmin II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7994 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location134646677-134762593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134747592 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 394 (M394L)
Ref Sequence ENSEMBL: ENSMUSP00000112438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121990] [ENSMUST00000188842]
Predicted Effect possibly damaging
Transcript: ENSMUST00000121990
AA Change: M394L

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112438
Gene: ENSMUSG00000026452
AA Change: M394L

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188842
AA Change: M394L

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140081
Gene: ENSMUSG00000026452
AA Change: M394L

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele are viable but sterile, weigh less and show ataxia and altered spontaneous and Ca2+-evoked neurotransmitter release. Mice homozygous for a null allele die at weaning showing growth arrest, motor dysfunction and impaired Ca2+-evoked neurotransmitter release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G C 5: 124,082,027 F318L probably benign Het
Adad1 T C 3: 37,091,971 I496T possibly damaging Het
Amotl1 T A 9: 14,593,361 N184Y probably damaging Het
Asz1 T C 6: 18,054,641 I388V probably benign Het
Brpf1 C G 6: 113,315,041 H349Q probably damaging Het
Cebpz T C 17: 78,934,599 D542G probably damaging Het
Cfap44 T C 16: 44,432,138 V870A probably damaging Het
Cnga1 T A 5: 72,604,660 I504F probably damaging Het
Col4a3 G A 1: 82,662,906 G315D unknown Het
Commd10 A G 18: 46,958,919 E11G possibly damaging Het
Coq9 A C 8: 94,853,157 N247H probably benign Het
Cort A T 4: 149,125,305 C97S probably damaging Het
D17Wsu92e C A 17: 27,767,943 A270S probably benign Het
Dclre1b T C 3: 103,803,386 D403G probably damaging Het
Efcab8 G A 2: 153,783,804 G128E Het
Ercc5 T C 1: 44,178,334 S946P possibly damaging Het
Fam19a4 C T 6: 96,863,886 E49K probably damaging Het
Fam221b C T 4: 43,665,514 V315M probably damaging Het
Fam3c T C 6: 22,308,460 K245E probably damaging Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gadd45g T C 13: 51,847,767 S123P possibly damaging Het
Gm49368 A G 7: 128,085,646 D396G possibly damaging Het
Gm8765 T A 13: 50,702,864 V846D probably benign Het
Gsto1 G A 19: 47,859,460 R132K probably benign Het
Gtf3c2 T C 5: 31,169,873 I327V possibly damaging Het
Hipk2 T C 6: 38,818,468 K289E possibly damaging Het
Igkv4-80 G T 6: 69,016,637 T90N probably benign Het
Madcam1 A T 10: 79,668,235 probably null Het
Mgat1 T C 11: 49,261,943 Y418H probably damaging Het
Myh10 T C 11: 68,790,244 probably null Het
Notch4 C A 17: 34,578,090 H937Q possibly damaging Het
Npas2 G T 1: 39,328,337 C313F possibly damaging Het
Nup93 A G 8: 94,306,302 M565V probably benign Het
Olfr119 C T 17: 37,701,435 T255I probably damaging Het
Olfr1375 T G 11: 51,048,140 V11G probably benign Het
Olfr424 G T 1: 174,136,707 probably benign Het
Olfr663 T A 7: 104,704,428 V287D probably damaging Het
Olfr68 T A 7: 103,777,400 H315L probably benign Het
Otop1 C T 5: 38,299,851 T318I probably benign Het
Pcdhgb6 A G 18: 37,742,671 E144G probably damaging Het
Plekha8 T C 6: 54,615,245 L18P probably damaging Het
Ppp1r13b T C 12: 111,832,342 D939G probably damaging Het
Prkag3 T A 1: 74,747,255 Q177L probably benign Het
Rcor3 C A 1: 192,101,645 S431I probably damaging Het
Scrib G A 15: 76,064,582 T475I probably damaging Het
Serpinb1a T A 13: 32,843,050 D303V probably damaging Het
Snrnp25 T A 11: 32,207,569 V49E probably benign Het
Sobp A T 10: 43,021,167 Y807* probably null Het
Srcap T C 7: 127,541,758 V1570A probably benign Het
Srcin1 C T 11: 97,531,916 V731M probably damaging Het
Tert T A 13: 73,648,955 I1104N probably benign Het
Ttn T C 2: 76,791,095 Y15667C probably damaging Het
Twnk A G 19: 45,007,838 T237A probably benign Het
Zfp157 T A 5: 138,455,188 probably null Het
Zfp503 C A 14: 21,985,006 S614I probably damaging Het
Zswim8 T A 14: 20,708,004 N52K possibly damaging Het
Other mutations in Syt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Syt2 APN 1 134745815 missense probably benign 0.07
IGL02476:Syt2 APN 1 134747631 missense probably benign 0.01
IGL02487:Syt2 APN 1 134740865 missense probably damaging 0.99
IGL02524:Syt2 APN 1 134741965 missense probably benign
IGL02611:Syt2 APN 1 134741882 missense possibly damaging 0.90
IGL03173:Syt2 APN 1 134743579 missense possibly damaging 0.81
IGL03303:Syt2 APN 1 134741911 missense probably benign 0.44
kringle UTSW 1 134747620 missense probably damaging 1.00
R1661:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R1665:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R2049:Syt2 UTSW 1 134746741 splice site probably benign
R2130:Syt2 UTSW 1 134746741 splice site probably benign
R2141:Syt2 UTSW 1 134746741 splice site probably benign
R3154:Syt2 UTSW 1 134741861 missense possibly damaging 0.95
R5392:Syt2 UTSW 1 134744021 missense probably damaging 1.00
R5431:Syt2 UTSW 1 134740957 missense probably benign 0.03
R6065:Syt2 UTSW 1 134747557 missense probably benign 0.00
R6381:Syt2 UTSW 1 134746850 missense probably damaging 1.00
R6816:Syt2 UTSW 1 134745800 missense probably damaging 1.00
R6923:Syt2 UTSW 1 134746763 missense possibly damaging 0.76
R7002:Syt2 UTSW 1 134744104 missense probably damaging 1.00
R7973:Syt2 UTSW 1 134740832 splice site probably null
R8410:Syt2 UTSW 1 134746864 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTTGTAGTGCACAGTGGCAGAG -3'
(R):5'- AGGTCGCGTAACTGAGGTATTG -3'

Sequencing Primer
(F):5'- AGAGGGCATGTCACTGGCTC -3'
(R):5'- CGCGTAACTGAGGTATTGATAGC -3'
Posted On2020-09-15