Incidental Mutation 'R7994:Cnga1'
ID 651924
Institutional Source Beutler Lab
Gene Symbol Cnga1
Ensembl Gene ENSMUSG00000067220
Gene Name cyclic nucleotide gated channel alpha 1
Synonyms Cncg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock # R7994 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 72603696-72644275 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 72604660 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 504 (I504F)
Ref Sequence ENSEMBL: ENSMUSP00000084464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087213] [ENSMUST00000169997] [ENSMUST00000201463]
AlphaFold P29974
Predicted Effect probably damaging
Transcript: ENSMUST00000087213
AA Change: I504F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084464
Gene: ENSMUSG00000067220
AA Change: I504F

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000169997
AA Change: I504F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132329
Gene: ENSMUSG00000067220
AA Change: I504F

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 194 388 4.7e-19 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000201463
AA Change: I504F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143881
Gene: ENSMUSG00000067220
AA Change: I504F

DomainStartEndE-ValueType
coiled coil region 111 150 N/A INTRINSIC
Pfam:Ion_trans 156 400 3e-33 PFAM
cNMP 471 595 3.31e-25 SMART
PDB:3SWF|C 615 684 6e-31 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in phototransduction. Along with another protein, the encoded protein forms a cGMP-gated cation channel in the plasma membrane, allowing depolarization of rod photoreceptors. This represents the last step in the phototransduction pathway. Defects in this gene are a cause of retinitis pigmentosa autosomal recessive (ARRP) disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G C 5: 124,082,027 F318L probably benign Het
Adad1 T C 3: 37,091,971 I496T possibly damaging Het
Amotl1 T A 9: 14,593,361 N184Y probably damaging Het
Asz1 T C 6: 18,054,641 I388V probably benign Het
Brpf1 C G 6: 113,315,041 H349Q probably damaging Het
Cebpz T C 17: 78,934,599 D542G probably damaging Het
Cfap44 T C 16: 44,432,138 V870A probably damaging Het
Col4a3 G A 1: 82,662,906 G315D unknown Het
Commd10 A G 18: 46,958,919 E11G possibly damaging Het
Coq9 A C 8: 94,853,157 N247H probably benign Het
Cort A T 4: 149,125,305 C97S probably damaging Het
D17Wsu92e C A 17: 27,767,943 A270S probably benign Het
Dclre1b T C 3: 103,803,386 D403G probably damaging Het
Efcab8 G A 2: 153,783,804 G128E Het
Ercc5 T C 1: 44,178,334 S946P possibly damaging Het
Fam19a4 C T 6: 96,863,886 E49K probably damaging Het
Fam221b C T 4: 43,665,514 V315M probably damaging Het
Fam3c T C 6: 22,308,460 K245E probably damaging Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gadd45g T C 13: 51,847,767 S123P possibly damaging Het
Gm49368 A G 7: 128,085,646 D396G possibly damaging Het
Gm8765 T A 13: 50,702,864 V846D probably benign Het
Gsto1 G A 19: 47,859,460 R132K probably benign Het
Gtf3c2 T C 5: 31,169,873 I327V possibly damaging Het
Hipk2 T C 6: 38,818,468 K289E possibly damaging Het
Igkv4-80 G T 6: 69,016,637 T90N probably benign Het
Madcam1 A T 10: 79,668,235 probably null Het
Mgat1 T C 11: 49,261,943 Y418H probably damaging Het
Myh10 T C 11: 68,790,244 probably null Het
Notch4 C A 17: 34,578,090 H937Q possibly damaging Het
Npas2 G T 1: 39,328,337 C313F possibly damaging Het
Nup93 A G 8: 94,306,302 M565V probably benign Het
Olfr119 C T 17: 37,701,435 T255I probably damaging Het
Olfr1375 T G 11: 51,048,140 V11G probably benign Het
Olfr424 G T 1: 174,136,707 probably benign Het
Olfr663 T A 7: 104,704,428 V287D probably damaging Het
Olfr68 T A 7: 103,777,400 H315L probably benign Het
Otop1 C T 5: 38,299,851 T318I probably benign Het
Pcdhgb6 A G 18: 37,742,671 E144G probably damaging Het
Plekha8 T C 6: 54,615,245 L18P probably damaging Het
Ppp1r13b T C 12: 111,832,342 D939G probably damaging Het
Prkag3 T A 1: 74,747,255 Q177L probably benign Het
Rcor3 C A 1: 192,101,645 S431I probably damaging Het
Scrib G A 15: 76,064,582 T475I probably damaging Het
Serpinb1a T A 13: 32,843,050 D303V probably damaging Het
Snrnp25 T A 11: 32,207,569 V49E probably benign Het
Sobp A T 10: 43,021,167 Y807* probably null Het
Srcap T C 7: 127,541,758 V1570A probably benign Het
Srcin1 C T 11: 97,531,916 V731M probably damaging Het
Syt2 A T 1: 134,747,592 M394L possibly damaging Het
Tert T A 13: 73,648,955 I1104N probably benign Het
Ttn T C 2: 76,791,095 Y15667C probably damaging Het
Twnk A G 19: 45,007,838 T237A probably benign Het
Zfp157 T A 5: 138,455,188 probably null Het
Zfp503 C A 14: 21,985,006 S614I probably damaging Het
Zswim8 T A 14: 20,708,004 N52K possibly damaging Het
Other mutations in Cnga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02332:Cnga1 APN 5 72604486 missense probably damaging 1.00
IGL02345:Cnga1 APN 5 72605272 missense probably benign 0.00
IGL02354:Cnga1 APN 5 72616718 splice site probably null
IGL02361:Cnga1 APN 5 72616718 splice site probably null
IGL03025:Cnga1 APN 5 72605413 missense probably benign
IGL03257:Cnga1 APN 5 72610862 missense probably damaging 1.00
tintoretto UTSW 5 72609500 missense probably damaging 1.00
IGL03046:Cnga1 UTSW 5 72604338 missense probably benign 0.01
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0238:Cnga1 UTSW 5 72605031 missense probably damaging 0.97
R0352:Cnga1 UTSW 5 72604503 missense possibly damaging 0.95
R1292:Cnga1 UTSW 5 72604683 missense probably damaging 1.00
R1386:Cnga1 UTSW 5 72612183 nonsense probably null
R1903:Cnga1 UTSW 5 72616725 missense possibly damaging 0.94
R2096:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2097:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2101:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2276:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2279:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2507:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R2508:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R3005:Cnga1 UTSW 5 72605107 missense probably damaging 1.00
R3779:Cnga1 UTSW 5 72604783 missense probably damaging 1.00
R4357:Cnga1 UTSW 5 72618252 missense probably damaging 1.00
R4399:Cnga1 UTSW 5 72604381 missense probably damaging 0.98
R4615:Cnga1 UTSW 5 72604774 missense probably damaging 1.00
R4946:Cnga1 UTSW 5 72604764 missense probably damaging 1.00
R5229:Cnga1 UTSW 5 72609500 missense probably damaging 1.00
R5474:Cnga1 UTSW 5 72605193 missense probably damaging 1.00
R5566:Cnga1 UTSW 5 72618250 missense probably damaging 0.98
R5754:Cnga1 UTSW 5 72605272 missense probably benign 0.00
R5899:Cnga1 UTSW 5 72619061 missense possibly damaging 0.85
R5906:Cnga1 UTSW 5 72610858 missense probably benign 0.19
R5954:Cnga1 UTSW 5 72604878 missense probably damaging 0.99
R5997:Cnga1 UTSW 5 72604575 missense probably damaging 0.98
R6087:Cnga1 UTSW 5 72610812 missense probably damaging 1.00
R6365:Cnga1 UTSW 5 72604945 missense probably benign 0.00
R6391:Cnga1 UTSW 5 72612359 critical splice donor site probably null
R6525:Cnga1 UTSW 5 72618231 missense probably damaging 1.00
R7046:Cnga1 UTSW 5 72629353 intron probably benign
R7229:Cnga1 UTSW 5 72618249 missense probably benign
R7299:Cnga1 UTSW 5 72605432 missense probably benign 0.20
R7367:Cnga1 UTSW 5 72605358 missense possibly damaging 0.75
R7425:Cnga1 UTSW 5 72609525 missense probably benign 0.12
R7449:Cnga1 UTSW 5 72605304 missense probably benign 0.29
R7538:Cnga1 UTSW 5 72612380 missense probably benign 0.24
R7808:Cnga1 UTSW 5 72604273 missense possibly damaging 0.69
R7922:Cnga1 UTSW 5 72604882 missense possibly damaging 0.81
R7938:Cnga1 UTSW 5 72604254 missense probably benign 0.27
R8249:Cnga1 UTSW 5 72605394 missense probably benign 0.02
R8690:Cnga1 UTSW 5 72604492 missense probably benign 0.15
R9689:Cnga1 UTSW 5 72604827 missense probably benign 0.10
X0062:Cnga1 UTSW 5 72604485 missense probably damaging 1.00
Z1177:Cnga1 UTSW 5 72605530 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCGATGCTCTTAATGTTGG -3'
(R):5'- ATGGTTTGACTACCTGTGGAC -3'

Sequencing Primer
(F):5'- CCGATGCTCTTAATGTTGGCTGTTC -3'
(R):5'- GAGAAGTCCTGAGATACCTCCCTG -3'
Posted On 2020-09-15