Incidental Mutation 'R7994:Fam3c'
ID651927
Institutional Source Beutler Lab
Gene Symbol Fam3c
Ensembl Gene ENSMUSG00000029672
Gene Namefamily with sequence similarity 3, member C
SynonymsFam3c, D6Wsu176e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R7994 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location22306520-22356243 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22308460 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 245 (K245E)
Ref Sequence ENSEMBL: ENSMUSP00000127559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081288] [ENSMUST00000163371] [ENSMUST00000163963] [ENSMUST00000165576]
Predicted Effect probably damaging
Transcript: ENSMUST00000081288
AA Change: K195E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080040
Gene: ENSMUSG00000029672
AA Change: K195E

DomainStartEndE-ValueType
PDB:2YOP|C 18 194 9e-45 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000163371
SMART Domains Protein: ENSMUSP00000128855
Gene: ENSMUSG00000029672

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163963
AA Change: K245E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127559
Gene: ENSMUSG00000029672
AA Change: K245E

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:ILEI 122 214 1.9e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165576
AA Change: K225E

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127709
Gene: ENSMUSG00000029672
AA Change: K225E

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PDB:2YOP|C 48 224 4e-44 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the family with sequence similarity 3 (FAM3) family and encodes a secreted protein with a GG domain. A change in expression of this protein has been noted in pancreatic cancer-derived cells. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out or gene trap allele exhibit normal skeletal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G C 5: 124,082,027 F318L probably benign Het
Adad1 T C 3: 37,091,971 I496T possibly damaging Het
Amotl1 T A 9: 14,593,361 N184Y probably damaging Het
Asz1 T C 6: 18,054,641 I388V probably benign Het
Brpf1 C G 6: 113,315,041 H349Q probably damaging Het
Cebpz T C 17: 78,934,599 D542G probably damaging Het
Cfap44 T C 16: 44,432,138 V870A probably damaging Het
Cnga1 T A 5: 72,604,660 I504F probably damaging Het
Col4a3 G A 1: 82,662,906 G315D unknown Het
Commd10 A G 18: 46,958,919 E11G possibly damaging Het
Coq9 A C 8: 94,853,157 N247H probably benign Het
Cort A T 4: 149,125,305 C97S probably damaging Het
D17Wsu92e C A 17: 27,767,943 A270S probably benign Het
Dclre1b T C 3: 103,803,386 D403G probably damaging Het
Efcab8 G A 2: 153,783,804 G128E Het
Ercc5 T C 1: 44,178,334 S946P possibly damaging Het
Fam19a4 C T 6: 96,863,886 E49K probably damaging Het
Fam221b C T 4: 43,665,514 V315M probably damaging Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gadd45g T C 13: 51,847,767 S123P possibly damaging Het
Gm49368 A G 7: 128,085,646 D396G possibly damaging Het
Gm8765 T A 13: 50,702,864 V846D probably benign Het
Gsto1 G A 19: 47,859,460 R132K probably benign Het
Gtf3c2 T C 5: 31,169,873 I327V possibly damaging Het
Hipk2 T C 6: 38,818,468 K289E possibly damaging Het
Igkv4-80 G T 6: 69,016,637 T90N probably benign Het
Madcam1 A T 10: 79,668,235 probably null Het
Mgat1 T C 11: 49,261,943 Y418H probably damaging Het
Myh10 T C 11: 68,790,244 probably null Het
Notch4 C A 17: 34,578,090 H937Q possibly damaging Het
Npas2 G T 1: 39,328,337 C313F possibly damaging Het
Nup93 A G 8: 94,306,302 M565V probably benign Het
Olfr119 C T 17: 37,701,435 T255I probably damaging Het
Olfr1375 T G 11: 51,048,140 V11G probably benign Het
Olfr424 G T 1: 174,136,707 probably benign Het
Olfr663 T A 7: 104,704,428 V287D probably damaging Het
Olfr68 T A 7: 103,777,400 H315L probably benign Het
Otop1 C T 5: 38,299,851 T318I probably benign Het
Pcdhgb6 A G 18: 37,742,671 E144G probably damaging Het
Plekha8 T C 6: 54,615,245 L18P probably damaging Het
Ppp1r13b T C 12: 111,832,342 D939G probably damaging Het
Prkag3 T A 1: 74,747,255 Q177L probably benign Het
Rcor3 C A 1: 192,101,645 S431I probably damaging Het
Scrib G A 15: 76,064,582 T475I probably damaging Het
Serpinb1a T A 13: 32,843,050 D303V probably damaging Het
Snrnp25 T A 11: 32,207,569 V49E probably benign Het
Sobp A T 10: 43,021,167 Y807* probably null Het
Srcap T C 7: 127,541,758 V1570A probably benign Het
Srcin1 C T 11: 97,531,916 V731M probably damaging Het
Syt2 A T 1: 134,747,592 M394L possibly damaging Het
Tert T A 13: 73,648,955 I1104N probably benign Het
Ttn T C 2: 76,791,095 Y15667C probably damaging Het
Twnk A G 19: 45,007,838 T237A probably benign Het
Zfp503 C A 14: 21,985,006 S614I probably damaging Het
Zswim8 T A 14: 20,708,004 N52K possibly damaging Het
Other mutations in Fam3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Fam3c APN 6 22318948 missense probably damaging 1.00
IGL01958:Fam3c APN 6 22318955 missense probably damaging 1.00
IGL02017:Fam3c APN 6 22343277 start codon destroyed probably null 0.66
PIT4812001:Fam3c UTSW 6 22321370 missense probably damaging 1.00
R1829:Fam3c UTSW 6 22309437 missense probably damaging 1.00
R2024:Fam3c UTSW 6 22329593 missense probably benign 0.33
R2884:Fam3c UTSW 6 22329582 missense probably damaging 0.98
R5481:Fam3c UTSW 6 22321358 missense probably benign 0.30
R5662:Fam3c UTSW 6 22355062 intron probably benign
R5911:Fam3c UTSW 6 22328561 missense probably damaging 1.00
R5911:Fam3c UTSW 6 22339300 missense probably benign 0.00
R6575:Fam3c UTSW 6 22329608 missense probably damaging 1.00
R6687:Fam3c UTSW 6 22328670 missense probably benign 0.03
R6982:Fam3c UTSW 6 22322301 missense probably damaging 1.00
R7570:Fam3c UTSW 6 22326405 intron probably benign
R7777:Fam3c UTSW 6 22328574 missense probably benign 0.19
R8082:Fam3c UTSW 6 22343304 missense unknown
R8254:Fam3c UTSW 6 22328676 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GTGCTTACAAATAGTTCAGTGATTGGC -3'
(R):5'- CATGTGTGTCACTGAAGCGAG -3'

Sequencing Primer
(F):5'- CAAAAAGGTAGCCATTTCTGTTAGC -3'
(R):5'- TGTCACTGAAGCGAGGGCAG -3'
Posted On2020-09-15