Incidental Mutation 'R7994:Myh10'
ID651945
Institutional Source Beutler Lab
Gene Symbol Myh10
Ensembl Gene ENSMUSG00000020900
Gene Namemyosin, heavy polypeptide 10, non-muscle
SynonymsMyosin IIB, Fltn, Fltn, Myhn-2, myosin IIB, nonmuscle myosin heavy chain II-B, NMHC-B, Myhn2, SMemb, NMHC II-B, 5730504C04Rik, nonmuscle myosin heavy chain IIB, 9330167F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7994 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location68691559-68816632 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 68790244 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000090661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018887] [ENSMUST00000092984] [ENSMUST00000102611]
Predicted Effect probably null
Transcript: ENSMUST00000018887
SMART Domains Protein: ENSMUSP00000018887
Gene: ENSMUSG00000020900

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.5e-15 PFAM
MYSc 79 815 N/A SMART
IQ 816 838 4.81e-4 SMART
low complexity region 932 946 N/A INTRINSIC
low complexity region 984 994 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1070 1086 N/A INTRINSIC
Pfam:Myosin_tail_1 1104 1961 6.5e-211 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000092984
SMART Domains Protein: ENSMUSP00000090661
Gene: ENSMUSG00000020900

DomainStartEndE-ValueType
Pfam:Myosin_N 70 110 2.5e-13 PFAM
MYSc 116 821 N/A SMART
IQ 822 844 4.81e-4 SMART
Pfam:Myosin_tail_1 885 1965 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102611
SMART Domains Protein: ENSMUSP00000099671
Gene: ENSMUSG00000020900

DomainStartEndE-ValueType
Pfam:Myosin_N 33 75 1.4e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 4.81e-4 SMART
low complexity region 901 915 N/A INTRINSIC
low complexity region 953 963 N/A INTRINSIC
low complexity region 1015 1027 N/A INTRINSIC
low complexity region 1039 1055 N/A INTRINSIC
Pfam:Myosin_tail_1 1073 1930 6.2e-211 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Nullizygous mice show pre- and neonatal death, heart defects and hydrocephaly. Deletion of exon B1 disrupts migration of facial neurons, whereas deletion of exon B2 leads to Purkinje cell anomalies. Hypomorphs show hydrocephaly and defects in motor control, cerebellar foliation and neuron migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G C 5: 124,082,027 F318L probably benign Het
Adad1 T C 3: 37,091,971 I496T possibly damaging Het
Amotl1 T A 9: 14,593,361 N184Y probably damaging Het
Asz1 T C 6: 18,054,641 I388V probably benign Het
Brpf1 C G 6: 113,315,041 H349Q probably damaging Het
Cebpz T C 17: 78,934,599 D542G probably damaging Het
Cfap44 T C 16: 44,432,138 V870A probably damaging Het
Cnga1 T A 5: 72,604,660 I504F probably damaging Het
Col4a3 G A 1: 82,662,906 G315D unknown Het
Commd10 A G 18: 46,958,919 E11G possibly damaging Het
Coq9 A C 8: 94,853,157 N247H probably benign Het
Cort A T 4: 149,125,305 C97S probably damaging Het
D17Wsu92e C A 17: 27,767,943 A270S probably benign Het
Dclre1b T C 3: 103,803,386 D403G probably damaging Het
Efcab8 G A 2: 153,783,804 G128E Het
Ercc5 T C 1: 44,178,334 S946P possibly damaging Het
Fam19a4 C T 6: 96,863,886 E49K probably damaging Het
Fam221b C T 4: 43,665,514 V315M probably damaging Het
Fam3c T C 6: 22,308,460 K245E probably damaging Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gadd45g T C 13: 51,847,767 S123P possibly damaging Het
Gm49368 A G 7: 128,085,646 D396G possibly damaging Het
Gm8765 T A 13: 50,702,864 V846D probably benign Het
Gsto1 G A 19: 47,859,460 R132K probably benign Het
Gtf3c2 T C 5: 31,169,873 I327V possibly damaging Het
Hipk2 T C 6: 38,818,468 K289E possibly damaging Het
Igkv4-80 G T 6: 69,016,637 T90N probably benign Het
Madcam1 A T 10: 79,668,235 probably null Het
Mgat1 T C 11: 49,261,943 Y418H probably damaging Het
Notch4 C A 17: 34,578,090 H937Q possibly damaging Het
Npas2 G T 1: 39,328,337 C313F possibly damaging Het
Nup93 A G 8: 94,306,302 M565V probably benign Het
Olfr119 C T 17: 37,701,435 T255I probably damaging Het
Olfr1375 T G 11: 51,048,140 V11G probably benign Het
Olfr424 G T 1: 174,136,707 probably benign Het
Olfr663 T A 7: 104,704,428 V287D probably damaging Het
Olfr68 T A 7: 103,777,400 H315L probably benign Het
Otop1 C T 5: 38,299,851 T318I probably benign Het
Pcdhgb6 A G 18: 37,742,671 E144G probably damaging Het
Plekha8 T C 6: 54,615,245 L18P probably damaging Het
Ppp1r13b T C 12: 111,832,342 D939G probably damaging Het
Prkag3 T A 1: 74,747,255 Q177L probably benign Het
Rcor3 C A 1: 192,101,645 S431I probably damaging Het
Scrib G A 15: 76,064,582 T475I probably damaging Het
Serpinb1a T A 13: 32,843,050 D303V probably damaging Het
Snrnp25 T A 11: 32,207,569 V49E probably benign Het
Sobp A T 10: 43,021,167 Y807* probably null Het
Srcap T C 7: 127,541,758 V1570A probably benign Het
Srcin1 C T 11: 97,531,916 V731M probably damaging Het
Syt2 A T 1: 134,747,592 M394L possibly damaging Het
Tert T A 13: 73,648,955 I1104N probably benign Het
Ttn T C 2: 76,791,095 Y15667C probably damaging Het
Twnk A G 19: 45,007,838 T237A probably benign Het
Zfp503 C A 14: 21,985,006 S614I probably damaging Het
Zswim8 T A 14: 20,708,004 N52K possibly damaging Het
Other mutations in Myh10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myh10 APN 11 68790708 missense probably benign 0.10
IGL01132:Myh10 APN 11 68768268 missense possibly damaging 0.93
IGL01348:Myh10 APN 11 68811803 missense probably benign 0.04
IGL01404:Myh10 APN 11 68752040 splice site probably null
IGL01409:Myh10 APN 11 68807219 missense probably damaging 0.98
IGL01660:Myh10 APN 11 68785889 missense probably benign 0.00
IGL02111:Myh10 APN 11 68790112 missense probably damaging 1.00
IGL02481:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02483:Myh10 APN 11 68802168 missense probably benign 0.00
IGL02502:Myh10 APN 11 68814372 splice site probably null
IGL03178:Myh10 APN 11 68699413 missense probably benign 0.19
algia UTSW 11 68802931 missense probably damaging 1.00
itis UTSW 11 68764245 missense probably damaging 0.96
PIT4802001:Myh10 UTSW 11 68765092 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0066:Myh10 UTSW 11 68699491 missense probably damaging 1.00
R0517:Myh10 UTSW 11 68811599 critical splice acceptor site probably null
R0855:Myh10 UTSW 11 68811801 missense possibly damaging 0.88
R1110:Myh10 UTSW 11 68791850 splice site probably benign
R1135:Myh10 UTSW 11 68807197 missense probably benign
R1169:Myh10 UTSW 11 68762841 missense probably damaging 0.99
R1643:Myh10 UTSW 11 68792010 missense probably damaging 0.96
R1733:Myh10 UTSW 11 68802296 missense probably benign 0.06
R1754:Myh10 UTSW 11 68813058 missense probably damaging 0.98
R1859:Myh10 UTSW 11 68745413 missense probably benign 0.03
R1898:Myh10 UTSW 11 68771906 missense probably damaging 1.00
R1905:Myh10 UTSW 11 68771868 splice site probably benign
R1914:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1915:Myh10 UTSW 11 68790208 missense probably damaging 0.99
R1987:Myh10 UTSW 11 68814496 missense possibly damaging 0.56
R2130:Myh10 UTSW 11 68807289 splice site probably benign
R2132:Myh10 UTSW 11 68807289 splice site probably benign
R2136:Myh10 UTSW 11 68804714 missense probably damaging 1.00
R2214:Myh10 UTSW 11 68783127 missense probably damaging 1.00
R2351:Myh10 UTSW 11 68793139 missense probably damaging 1.00
R3407:Myh10 UTSW 11 68790211 missense possibly damaging 0.68
R3721:Myh10 UTSW 11 68813052 missense probably damaging 0.99
R3908:Myh10 UTSW 11 68771059 critical splice donor site probably null
R4275:Myh10 UTSW 11 68751940 critical splice acceptor site probably null
R4526:Myh10 UTSW 11 68815049 missense probably benign 0.04
R4666:Myh10 UTSW 11 68801730 critical splice donor site probably null
R4668:Myh10 UTSW 11 68804642 missense probably damaging 1.00
R4750:Myh10 UTSW 11 68785314 missense probably damaging 1.00
R4968:Myh10 UTSW 11 68793223 missense probably damaging 1.00
R4977:Myh10 UTSW 11 68798371 missense possibly damaging 0.55
R5201:Myh10 UTSW 11 68783195 missense probably damaging 1.00
R5288:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5304:Myh10 UTSW 11 68764245 missense probably damaging 0.96
R5366:Myh10 UTSW 11 68760692 missense probably damaging 0.97
R5384:Myh10 UTSW 11 68801608 missense probably damaging 1.00
R5427:Myh10 UTSW 11 68802931 missense probably damaging 1.00
R5546:Myh10 UTSW 11 68798380 missense possibly damaging 0.90
R5551:Myh10 UTSW 11 68768287 missense possibly damaging 0.65
R5777:Myh10 UTSW 11 68785859 missense probably damaging 1.00
R5995:Myh10 UTSW 11 68814983 missense probably benign 0.01
R6021:Myh10 UTSW 11 68808862 missense possibly damaging 0.72
R6171:Myh10 UTSW 11 68791890 missense probably damaging 1.00
R6179:Myh10 UTSW 11 68802153 missense probably damaging 0.98
R6263:Myh10 UTSW 11 68810232 missense probably damaging 0.98
R6264:Myh10 UTSW 11 68745415 missense probably benign 0.01
R6484:Myh10 UTSW 11 68699467 missense probably damaging 1.00
R6575:Myh10 UTSW 11 68808850 missense probably benign 0.00
R6736:Myh10 UTSW 11 68745339 missense probably damaging 1.00
R7141:Myh10 UTSW 11 68802139 missense probably benign
R7256:Myh10 UTSW 11 68790689 missense probably damaging 1.00
R7329:Myh10 UTSW 11 68810191 missense probably benign 0.44
R7363:Myh10 UTSW 11 68815048 missense probably benign
R7576:Myh10 UTSW 11 68802166 missense probably damaging 1.00
R7577:Myh10 UTSW 11 68745980 missense unknown
R7681:Myh10 UTSW 11 68771936 missense probably damaging 0.98
R7813:Myh10 UTSW 11 68785909 missense probably benign 0.00
R7834:Myh10 UTSW 11 68785826 missense probably damaging 1.00
R7922:Myh10 UTSW 11 68808893 missense possibly damaging 0.56
R7938:Myh10 UTSW 11 68692501 missense unknown
R7958:Myh10 UTSW 11 68721347 missense probably benign 0.00
R8395:Myh10 UTSW 11 68792016 missense probably damaging 0.98
X0028:Myh10 UTSW 11 68793135 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGAGACACTGACGTAGG -3'
(R):5'- TGTGCTCAGAGCCCAAATAC -3'

Sequencing Primer
(F):5'- TTCCCAGGACCTAGAAGAAC -3'
(R):5'- CACTACAAGTGGCGTAGATGG -3'
Posted On2020-09-15