Incidental Mutation 'R7994:Tert'
ID651951
Institutional Source Beutler Lab
Gene Symbol Tert
Ensembl Gene ENSMUSG00000021611
Gene Nametelomerase reverse transcriptase
SynonymsTR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.432) question?
Stock #R7994 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73626911-73649843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73648955 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1104 (I1104N)
Ref Sequence ENSEMBL: ENSMUSP00000022104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022104] [ENSMUST00000221522] [ENSMUST00000223303]
Predicted Effect probably benign
Transcript: ENSMUST00000022104
AA Change: I1104N

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022104
Gene: ENSMUSG00000021611
AA Change: I1104N

DomainStartEndE-ValueType
Blast:Telomerase_RBD 329 375 2e-6 BLAST
Telomerase_RBD 449 584 5.02e-75 SMART
Blast:Telomerase_RBD 651 688 1e-5 BLAST
Pfam:RVT_1 787 918 6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221522
Predicted Effect probably benign
Transcript: ENSMUST00000223303
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: In spite of impaired telomerase function, homozygous mutant mice are overtly normal in early generations. Impaired fertility has been reported in later generations for homozygotes of at least one knockout allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G C 5: 124,082,027 F318L probably benign Het
Adad1 T C 3: 37,091,971 I496T possibly damaging Het
Amotl1 T A 9: 14,593,361 N184Y probably damaging Het
Asz1 T C 6: 18,054,641 I388V probably benign Het
Brpf1 C G 6: 113,315,041 H349Q probably damaging Het
Cebpz T C 17: 78,934,599 D542G probably damaging Het
Cfap44 T C 16: 44,432,138 V870A probably damaging Het
Cnga1 T A 5: 72,604,660 I504F probably damaging Het
Col4a3 G A 1: 82,662,906 G315D unknown Het
Commd10 A G 18: 46,958,919 E11G possibly damaging Het
Coq9 A C 8: 94,853,157 N247H probably benign Het
Cort A T 4: 149,125,305 C97S probably damaging Het
D17Wsu92e C A 17: 27,767,943 A270S probably benign Het
Dclre1b T C 3: 103,803,386 D403G probably damaging Het
Efcab8 G A 2: 153,783,804 G128E Het
Ercc5 T C 1: 44,178,334 S946P possibly damaging Het
Fam19a4 C T 6: 96,863,886 E49K probably damaging Het
Fam221b C T 4: 43,665,514 V315M probably damaging Het
Fam3c T C 6: 22,308,460 K245E probably damaging Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gadd45g T C 13: 51,847,767 S123P possibly damaging Het
Gm49368 A G 7: 128,085,646 D396G possibly damaging Het
Gm8765 T A 13: 50,702,864 V846D probably benign Het
Gsto1 G A 19: 47,859,460 R132K probably benign Het
Gtf3c2 T C 5: 31,169,873 I327V possibly damaging Het
Hipk2 T C 6: 38,818,468 K289E possibly damaging Het
Igkv4-80 G T 6: 69,016,637 T90N probably benign Het
Madcam1 A T 10: 79,668,235 probably null Het
Mgat1 T C 11: 49,261,943 Y418H probably damaging Het
Myh10 T C 11: 68,790,244 probably null Het
Notch4 C A 17: 34,578,090 H937Q possibly damaging Het
Npas2 G T 1: 39,328,337 C313F possibly damaging Het
Nup93 A G 8: 94,306,302 M565V probably benign Het
Olfr119 C T 17: 37,701,435 T255I probably damaging Het
Olfr1375 T G 11: 51,048,140 V11G probably benign Het
Olfr424 G T 1: 174,136,707 probably benign Het
Olfr663 T A 7: 104,704,428 V287D probably damaging Het
Olfr68 T A 7: 103,777,400 H315L probably benign Het
Otop1 C T 5: 38,299,851 T318I probably benign Het
Pcdhgb6 A G 18: 37,742,671 E144G probably damaging Het
Plekha8 T C 6: 54,615,245 L18P probably damaging Het
Ppp1r13b T C 12: 111,832,342 D939G probably damaging Het
Prkag3 T A 1: 74,747,255 Q177L probably benign Het
Rcor3 C A 1: 192,101,645 S431I probably damaging Het
Scrib G A 15: 76,064,582 T475I probably damaging Het
Serpinb1a T A 13: 32,843,050 D303V probably damaging Het
Snrnp25 T A 11: 32,207,569 V49E probably benign Het
Sobp A T 10: 43,021,167 Y807* probably null Het
Srcap T C 7: 127,541,758 V1570A probably benign Het
Srcin1 C T 11: 97,531,916 V731M probably damaging Het
Syt2 A T 1: 134,747,592 M394L possibly damaging Het
Ttn T C 2: 76,791,095 Y15667C probably damaging Het
Twnk A G 19: 45,007,838 T237A probably benign Het
Zfp157 T A 5: 138,455,188 probably null Het
Zfp503 C A 14: 21,985,006 S614I probably damaging Het
Zswim8 T A 14: 20,708,004 N52K possibly damaging Het
Other mutations in Tert
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Tert APN 13 73628297 missense possibly damaging 0.76
IGL01585:Tert APN 13 73634344 missense probably benign 0.15
IGL03167:Tert APN 13 73640000 missense probably damaging 1.00
FR4304:Tert UTSW 13 73648302 utr 3 prime probably benign
FR4342:Tert UTSW 13 73648300 utr 3 prime probably benign
FR4589:Tert UTSW 13 73648304 utr 3 prime probably benign
PIT4377001:Tert UTSW 13 73628261 missense possibly damaging 0.54
R0372:Tert UTSW 13 73648991 missense probably damaging 1.00
R0433:Tert UTSW 13 73627081 missense probably damaging 1.00
R0829:Tert UTSW 13 73644385 missense probably damaging 1.00
R1023:Tert UTSW 13 73642059 missense probably benign 0.41
R1236:Tert UTSW 13 73636379 missense probably damaging 0.99
R1331:Tert UTSW 13 73648354 missense probably damaging 1.00
R1426:Tert UTSW 13 73642353 splice site probably benign
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1467:Tert UTSW 13 73628209 missense probably benign 0.10
R1521:Tert UTSW 13 73642056 missense probably damaging 1.00
R2484:Tert UTSW 13 73647985 missense probably benign
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R3162:Tert UTSW 13 73627409 missense possibly damaging 0.45
R4428:Tert UTSW 13 73627475 missense probably damaging 1.00
R4430:Tert UTSW 13 73627475 missense probably damaging 1.00
R4431:Tert UTSW 13 73627475 missense probably damaging 1.00
R4630:Tert UTSW 13 73648991 missense probably damaging 1.00
R4696:Tert UTSW 13 73627820 missense probably benign 0.25
R4751:Tert UTSW 13 73628063 missense possibly damaging 0.89
R4926:Tert UTSW 13 73648389 missense possibly damaging 0.62
R5011:Tert UTSW 13 73646309 critical splice donor site probably null
R5013:Tert UTSW 13 73646309 critical splice donor site probably null
R5061:Tert UTSW 13 73634278 missense probably damaging 1.00
R5268:Tert UTSW 13 73627354 missense probably damaging 1.00
R5323:Tert UTSW 13 73648371 missense probably benign 0.07
R5396:Tert UTSW 13 73639243 missense probably damaging 0.97
R5445:Tert UTSW 13 73644284 missense probably benign 0.00
R5680:Tert UTSW 13 73642351 splice site probably null
R5688:Tert UTSW 13 73639156 missense probably damaging 1.00
R6092:Tert UTSW 13 73628581 missense probably benign 0.34
R6973:Tert UTSW 13 73627988 missense probably benign 0.02
R7069:Tert UTSW 13 73628410 missense probably damaging 0.99
R7317:Tert UTSW 13 73642376 missense probably damaging 1.00
R7747:Tert UTSW 13 73627606 missense probably damaging 1.00
R7787:Tert UTSW 13 73648932 missense probably damaging 0.99
R7846:Tert UTSW 13 73628195 missense probably damaging 1.00
R8042:Tert UTSW 13 73627145 missense probably damaging 1.00
R8044:Tert UTSW 13 73635449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGATTGTCAAGCTTGAGG -3'
(R):5'- CACAGAGGTTTGGAGGATGACC -3'

Sequencing Primer
(F):5'- CCAGATTGTCAAGCTTGAGGTCTTTG -3'
(R):5'- GGATGACCTAGCCTCACAACTG -3'
Posted On2020-09-15