Incidental Mutation 'R7994:D17Wsu92e'
ID651956
Institutional Source Beutler Lab
Gene Symbol D17Wsu92e
Ensembl Gene ENSMUSG00000056692
Gene NameDNA segment, Chr 17, Wayne State University 92, expressed
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7994 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location27751232-27820558 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27767943 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 270 (A270S)
Ref Sequence ENSEMBL: ENSMUSP00000074585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075076] [ENSMUST00000114859] [ENSMUST00000114863]
Predicted Effect probably benign
Transcript: ENSMUST00000075076
AA Change: A270S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074585
Gene: ENSMUSG00000056692
AA Change: A270S

DomainStartEndE-ValueType
Pfam:UBA_4 25 68 1.6e-13 PFAM
Pfam:N_BRCA1_IG 80 179 1.6e-37 PFAM
low complexity region 257 276 N/A INTRINSIC
low complexity region 282 291 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114859
SMART Domains Protein: ENSMUSP00000110509
Gene: ENSMUSG00000056692

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 5.1e-15 PFAM
PDB:4OLE|D 74 180 2e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114863
AA Change: A270S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110513
Gene: ENSMUSG00000056692
AA Change: A270S

DomainStartEndE-ValueType
Pfam:UBA_4 25 69 2.2e-14 PFAM
PDB:4OLE|D 74 180 8e-9 PDB
low complexity region 257 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G C 5: 124,082,027 F318L probably benign Het
Adad1 T C 3: 37,091,971 I496T possibly damaging Het
Amotl1 T A 9: 14,593,361 N184Y probably damaging Het
Asz1 T C 6: 18,054,641 I388V probably benign Het
Brpf1 C G 6: 113,315,041 H349Q probably damaging Het
Cebpz T C 17: 78,934,599 D542G probably damaging Het
Cfap44 T C 16: 44,432,138 V870A probably damaging Het
Cnga1 T A 5: 72,604,660 I504F probably damaging Het
Col4a3 G A 1: 82,662,906 G315D unknown Het
Commd10 A G 18: 46,958,919 E11G possibly damaging Het
Coq9 A C 8: 94,853,157 N247H probably benign Het
Cort A T 4: 149,125,305 C97S probably damaging Het
Dclre1b T C 3: 103,803,386 D403G probably damaging Het
Efcab8 G A 2: 153,783,804 G128E Het
Ercc5 T C 1: 44,178,334 S946P possibly damaging Het
Fam19a4 C T 6: 96,863,886 E49K probably damaging Het
Fam221b C T 4: 43,665,514 V315M probably damaging Het
Fam3c T C 6: 22,308,460 K245E probably damaging Het
Gabbr2 C T 4: 46,736,349 probably null Het
Gadd45g T C 13: 51,847,767 S123P possibly damaging Het
Gm49368 A G 7: 128,085,646 D396G possibly damaging Het
Gm8765 T A 13: 50,702,864 V846D probably benign Het
Gsto1 G A 19: 47,859,460 R132K probably benign Het
Gtf3c2 T C 5: 31,169,873 I327V possibly damaging Het
Hipk2 T C 6: 38,818,468 K289E possibly damaging Het
Igkv4-80 G T 6: 69,016,637 T90N probably benign Het
Madcam1 A T 10: 79,668,235 probably null Het
Mgat1 T C 11: 49,261,943 Y418H probably damaging Het
Myh10 T C 11: 68,790,244 probably null Het
Notch4 C A 17: 34,578,090 H937Q possibly damaging Het
Npas2 G T 1: 39,328,337 C313F possibly damaging Het
Nup93 A G 8: 94,306,302 M565V probably benign Het
Olfr119 C T 17: 37,701,435 T255I probably damaging Het
Olfr1375 T G 11: 51,048,140 V11G probably benign Het
Olfr424 G T 1: 174,136,707 probably benign Het
Olfr663 T A 7: 104,704,428 V287D probably damaging Het
Olfr68 T A 7: 103,777,400 H315L probably benign Het
Otop1 C T 5: 38,299,851 T318I probably benign Het
Pcdhgb6 A G 18: 37,742,671 E144G probably damaging Het
Plekha8 T C 6: 54,615,245 L18P probably damaging Het
Ppp1r13b T C 12: 111,832,342 D939G probably damaging Het
Prkag3 T A 1: 74,747,255 Q177L probably benign Het
Rcor3 C A 1: 192,101,645 S431I probably damaging Het
Scrib G A 15: 76,064,582 T475I probably damaging Het
Serpinb1a T A 13: 32,843,050 D303V probably damaging Het
Snrnp25 T A 11: 32,207,569 V49E probably benign Het
Sobp A T 10: 43,021,167 Y807* probably null Het
Srcap T C 7: 127,541,758 V1570A probably benign Het
Srcin1 C T 11: 97,531,916 V731M probably damaging Het
Syt2 A T 1: 134,747,592 M394L possibly damaging Het
Tert T A 13: 73,648,955 I1104N probably benign Het
Ttn T C 2: 76,791,095 Y15667C probably damaging Het
Twnk A G 19: 45,007,838 T237A probably benign Het
Zfp157 T A 5: 138,455,188 probably null Het
Zfp503 C A 14: 21,985,006 S614I probably damaging Het
Zswim8 T A 14: 20,708,004 N52K possibly damaging Het
Other mutations in D17Wsu92e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:D17Wsu92e APN 17 27767919 missense probably damaging 1.00
IGL01107:D17Wsu92e APN 17 27786069 critical splice donor site probably null
IGL01805:D17Wsu92e APN 17 27767906 splice site probably benign
detroit UTSW 17 27794070 splice site probably null
michigander UTSW 17 27767986 missense probably benign 0.12
R0423:D17Wsu92e UTSW 17 27786233 missense probably damaging 1.00
R0833:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R0836:D17Wsu92e UTSW 17 27786138 missense probably damaging 1.00
R1055:D17Wsu92e UTSW 17 27767936 missense probably damaging 1.00
R1251:D17Wsu92e UTSW 17 27786070 critical splice donor site probably null
R1646:D17Wsu92e UTSW 17 27793960 missense probably damaging 1.00
R4022:D17Wsu92e UTSW 17 27786262 missense probably damaging 0.97
R4604:D17Wsu92e UTSW 17 27820315 missense probably damaging 1.00
R5360:D17Wsu92e UTSW 17 27794046 missense probably damaging 1.00
R6210:D17Wsu92e UTSW 17 27767986 missense probably benign 0.12
R7201:D17Wsu92e UTSW 17 27794070 splice site probably null
R8057:D17Wsu92e UTSW 17 27767889 missense unknown
R8767:D17Wsu92e UTSW 17 27768069 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGACGGCTGACTCATGGTG -3'
(R):5'- AGCAGCTGTCATCTTTTGAAACG -3'

Sequencing Primer
(F):5'- ACGGCTGACTCATGGTGACTAC -3'
(R):5'- GGAAACTTCAACCCGTTTGC -3'
Posted On2020-09-15