Incidental Mutation 'R7931:Nvl'
ID 651965
Institutional Source Beutler Lab
Gene Symbol Nvl
Ensembl Gene ENSMUSG00000026516
Gene Name nuclear VCP-like
Synonyms 1200009I24Rik
MMRRC Submission 045978-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R7931 (G1)
Quality Score 999
Status Validated
Chromosome 1
Chromosomal Location 180914703-180971769 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) C to T at 180936720 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027797]
AlphaFold Q9DBY8
PDB Structure Structure and function of the N-terminal nucleolin binding domain of nuclear valocine containing protein like 2 (NVL2) harboring a nucleolar localization signal [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000027797
SMART Domains Protein: ENSMUSP00000027797
Gene: ENSMUSG00000026516

DomainStartEndE-ValueType
Pfam:Nucleolin_bd 2 72 1.9e-31 PFAM
low complexity region 90 104 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
AAA 296 435 2.94e-23 SMART
low complexity region 524 540 N/A INTRINSIC
AAA 613 749 2.56e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AAA (ATPases associated with diverse cellular activities) superfamily. Multiple transcript variants encoding different isoforms have been found for this gene. Two encoded proteins, described as major and minor isoforms, have been localized to distinct regions of the nucleus. The largest encoded protein (major isoform) has been localized to the nucleolus and shown to participate in ribosome biosynthesis (PMID: 15469983, 16782053), while the minor isoform has been localized to the nucleoplasmin. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 A T 2: 91,037,060 (GRCm39) probably null Het
Aire G A 10: 77,866,130 (GRCm39) A536V probably damaging Het
Aox4 A G 1: 58,294,645 (GRCm39) I951M probably benign Het
Ash1l G T 3: 88,950,848 (GRCm39) C2190F probably damaging Het
C1s1 C T 6: 124,510,359 (GRCm39) V363M probably damaging Het
Col7a1 C A 9: 108,809,590 (GRCm39) probably benign Het
Coq10b A G 1: 55,092,152 (GRCm39) probably benign Het
Diaph3 A T 14: 87,352,456 (GRCm39) D48E possibly damaging Het
Dnajc13 A G 9: 104,095,763 (GRCm39) V559A probably benign Het
Dzank1 T C 2: 144,323,614 (GRCm39) I610V probably benign Het
F7 A G 8: 13,085,209 (GRCm39) I412V probably benign Het
Flt1 A G 5: 147,525,382 (GRCm39) S919P probably damaging Het
Gm10800 AAGAAAACTGAAAATCAT A 2: 98,497,379 (GRCm39) probably benign Het
Gria1 A G 11: 57,201,351 (GRCm39) probably benign Het
Hoxa13 G GCA 6: 52,237,620 (GRCm39) probably null Het
Igkv4-70 C A 6: 69,244,975 (GRCm39) R82L probably damaging Het
Lnp1 T A 16: 56,748,281 (GRCm39) R4* probably null Het
Lrrc3b T C 14: 15,358,018 (GRCm38) N196S probably benign Het
Mlxip A G 5: 123,588,558 (GRCm39) D816G probably damaging Het
Myh7 C T 14: 55,221,119 (GRCm39) E935K possibly damaging Het
Myom3 A T 4: 135,516,947 (GRCm39) H839L probably benign Het
Nebl C T 2: 17,381,433 (GRCm39) probably null Het
Ninj1 T C 13: 49,347,432 (GRCm39) I99T probably damaging Het
Or11g1 A C 14: 50,651,786 (GRCm39) M262L probably damaging Het
Or2l5 A G 16: 19,334,258 (GRCm39) S43P possibly damaging Het
Or4a76 T A 2: 89,460,448 (GRCm39) I265F possibly damaging Het
Or8g55 A T 9: 39,785,146 (GRCm39) T192S possibly damaging Het
Otop1 A G 5: 38,445,364 (GRCm39) H174R probably damaging Het
Pcdhb16 A G 18: 37,611,510 (GRCm39) N157D possibly damaging Het
Prss44 A C 9: 110,643,746 (GRCm39) Q130P probably damaging Het
Ptprh C A 7: 4,574,987 (GRCm39) S344I probably benign Het
Rps6kl1 T C 12: 85,196,566 (GRCm39) I33V possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Scn1a T C 2: 66,148,156 (GRCm39) S110G probably damaging Het
Sdk2 C A 11: 113,784,267 (GRCm39) K157N possibly damaging Het
Serpina1d A T 12: 103,733,815 (GRCm39) V163D probably damaging Het
Serpina3g T C 12: 104,205,428 (GRCm39) S56P probably benign Het
Slc4a4 T C 5: 89,318,640 (GRCm39) L636P probably benign Het
Slc6a1 T C 6: 114,288,863 (GRCm39) F474S probably benign Het
Slco6d1 A G 1: 98,356,141 (GRCm39) D235G probably damaging Het
Srgn A T 10: 62,330,763 (GRCm39) M114K possibly damaging Het
Syne3 A T 12: 104,929,491 (GRCm39) V243E probably damaging Het
Tbc1d5 T C 17: 51,106,892 (GRCm39) probably benign Het
Tcf19 A G 17: 35,825,804 (GRCm39) F118L probably damaging Het
Tln2 A T 9: 67,165,742 (GRCm39) probably null Het
Tnxb A G 17: 34,907,672 (GRCm39) T1239A probably damaging Het
Traip A G 9: 107,848,241 (GRCm39) I453M probably benign Het
Usp5 T C 6: 124,801,409 (GRCm39) probably benign Het
Vmn1r157 C T 7: 22,461,210 (GRCm39) A30V probably damaging Het
Vmn1r233 G A 17: 21,214,125 (GRCm39) A275V probably benign Het
Vps13d G A 4: 144,822,854 (GRCm39) R2976* probably null Het
Wdr75 T C 1: 45,858,795 (GRCm39) F655L probably benign Het
Wwp1 A G 4: 19,650,114 (GRCm39) probably null Het
Zc3h4 T C 7: 16,166,909 (GRCm39) L747P unknown Het
Zfp268 G A 4: 145,349,126 (GRCm39) D188N possibly damaging Het
Other mutations in Nvl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Nvl APN 1 180,932,690 (GRCm39) missense probably damaging 1.00
IGL00943:Nvl APN 1 180,929,199 (GRCm39) missense possibly damaging 0.72
IGL01956:Nvl APN 1 180,962,509 (GRCm39) missense probably benign 0.00
IGL02657:Nvl APN 1 180,934,541 (GRCm39) missense probably damaging 1.00
Nineveh UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
nubia UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
IGL03098:Nvl UTSW 1 180,921,471 (GRCm39) missense probably benign 0.37
P0047:Nvl UTSW 1 180,939,867 (GRCm39) missense probably damaging 1.00
R0003:Nvl UTSW 1 180,941,698 (GRCm39) missense probably damaging 1.00
R0114:Nvl UTSW 1 180,947,956 (GRCm39) missense probably benign 0.19
R0265:Nvl UTSW 1 180,962,395 (GRCm39) missense probably damaging 0.96
R0928:Nvl UTSW 1 180,921,467 (GRCm39) missense probably benign 0.00
R1398:Nvl UTSW 1 180,924,691 (GRCm39) splice site probably benign
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1470:Nvl UTSW 1 180,966,827 (GRCm39) missense probably damaging 1.00
R1529:Nvl UTSW 1 180,936,724 (GRCm39) critical splice donor site probably null
R1934:Nvl UTSW 1 180,926,693 (GRCm39) missense probably damaging 0.96
R2176:Nvl UTSW 1 180,962,639 (GRCm39) splice site probably benign
R2351:Nvl UTSW 1 180,958,357 (GRCm39) missense probably benign 0.03
R4415:Nvl UTSW 1 180,932,679 (GRCm39) missense probably benign
R4570:Nvl UTSW 1 180,971,647 (GRCm39) missense probably benign 0.03
R4720:Nvl UTSW 1 180,929,152 (GRCm39) missense probably damaging 1.00
R4888:Nvl UTSW 1 180,945,191 (GRCm39) missense probably damaging 1.00
R5026:Nvl UTSW 1 180,932,720 (GRCm39) missense probably damaging 1.00
R5507:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R5785:Nvl UTSW 1 180,966,863 (GRCm39) missense probably damaging 1.00
R5983:Nvl UTSW 1 180,964,471 (GRCm39) missense probably benign 0.00
R6143:Nvl UTSW 1 180,962,560 (GRCm39) missense probably benign 0.01
R6532:Nvl UTSW 1 180,971,708 (GRCm39) splice site probably null
R6821:Nvl UTSW 1 180,954,535 (GRCm39) nonsense probably null
R7062:Nvl UTSW 1 180,939,899 (GRCm39) missense probably benign 0.19
R7247:Nvl UTSW 1 180,939,851 (GRCm39) critical splice donor site probably null
R7358:Nvl UTSW 1 180,962,601 (GRCm39) missense probably damaging 0.98
R7665:Nvl UTSW 1 180,962,509 (GRCm39) missense probably benign 0.18
R7795:Nvl UTSW 1 180,924,722 (GRCm39) missense probably benign 0.00
R8185:Nvl UTSW 1 180,971,739 (GRCm39) unclassified probably benign
R8806:Nvl UTSW 1 180,922,619 (GRCm39) missense probably benign 0.01
R8933:Nvl UTSW 1 180,966,638 (GRCm39) missense probably benign 0.00
R8975:Nvl UTSW 1 180,958,001 (GRCm39) missense probably benign
R9249:Nvl UTSW 1 180,962,593 (GRCm39) missense probably damaging 1.00
R9584:Nvl UTSW 1 180,958,431 (GRCm39) missense probably benign
R9586:Nvl UTSW 1 180,932,635 (GRCm39) critical splice donor site probably null
X0067:Nvl UTSW 1 180,966,723 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTGAAGTGTCTGACAAATAGCAGAG -3'
(R):5'- GGCCTCTCTTCAGTTGAATAGAG -3'

Sequencing Primer
(F):5'- TGTCTGACAAATAGCAGAGAACAAAC -3'
(R):5'- GCTCATTGATAAACTCAGGTGTGCC -3'
Posted On 2020-09-16