Mutagenetix > Incidental Mutation

Incidental Mutation 'R8088:Sspo'

651978

Institutional Source

Beutler Lab

Gene Symbol

Sspo

Ensembl Gene

ENSMUSG00000029797

Gene Name

SCO-spondin

Synonyms

C79529, Scospondin

MMRRC Submission

067521-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8088 (G1)

Quality Score

55.0072

Status

Validated

Chromosome

Chromosomal Location

48425163-48478184 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 48434547 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 1013 (C1013Y)

Ref Sequence

ENSEMBL: ENSMUSP00000131401 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043676] [ENSMUST00000169350] [ENSMUST00000212740]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043676
AA Change: C890Y

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000047991
Gene: ENSMUSG00000029797
AA Change: C890Y

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	126	135	N/A	INTRINSIC
Pfam:VWD	154	219	7.4e-11	PFAM
C8	267	346	2.3e-10	SMART
Pfam:TIL	349	404	3.2e-13	PFAM
VWC	406	448	2e-1	SMART
VWD	433	593	5.08e-29	SMART
C8	631	703	2.14e-28	SMART
Pfam:TIL	706	759	5.8e-11	PFAM
VWC	856	924	4.76e-2	SMART
VWD	883	1042	9.59e-48	SMART
C8	1076	1150	3.62e-26	SMART
Pfam:TIL	1153	1209	2.6e-13	PFAM
LDLa	1253	1291	2.29e-13	SMART
LDLa	1293	1328	1.87e-9	SMART
LDLa	1329	1366	5.77e-10	SMART
LDLa	1369	1408	1.52e-9	SMART
LDLa	1442	1479	2.55e-11	SMART
LDLa	1480	1520	5.6e-8	SMART
LDLa	1533	1574	2.29e-4	SMART
TSP1	1575	1626	6.47e-13	SMART
TSP1	1631	1686	1.35e-10	SMART
Pfam:TIL	1690	1746	3.1e-9	PFAM
TSP1	1774	1827	6.94e-2	SMART
VWC	1829	1886	4.95e-9	SMART
low complexity region	1901	1911	N/A	INTRINSIC
FA58C	1928	2085	1.4e-2	SMART
LDLa	2091	2128	1.48e-7	SMART
LDLa	2242	2279	5.68e-9	SMART
LDLa	2299	2336	5.77e-10	SMART
TSP1	2339	2389	1.42e-9	SMART
TSP1	2394	2446	6.36e-21	SMART
Pfam:TIL	2460	2511	5.7e-10	PFAM
VWC	2513	2567	2.48e-1	SMART
TSP1	2554	2605	3.07e-14	SMART
TSP1	2611	2664	4.05e-5	SMART
TSP1	2669	2719	1.83e-12	SMART
EGF_like	2733	2776	5.45e1	SMART
VWC	2783	2836	2.73e-11	SMART
TSP1	2823	2875	3.72e-13	SMART
TSP1	2878	2919	6.05e-4	SMART
Pfam:TIL	2926	2978	1.1e-11	PFAM
VWC	2980	3035	9.77e-2	SMART
TSP1	3022	3086	6.68e-6	SMART
TSP1	3091	3143	1.08e-14	SMART
Pfam:TIL	3147	3201	2.2e-9	PFAM
VWC	3203	3260	2.72e-1	SMART
TSP1	3247	3306	3.72e-4	SMART
TSP1	3311	3363	5.27e-4	SMART
Pfam:TIL	3365	3421	4.2e-9	PFAM
TSP1	3484	3529	1.87e-9	SMART
low complexity region	3591	3601	N/A	INTRINSIC
TSP1	3660	3713	5.02e-10	SMART
TSP1	3730	3779	2.95e-7	SMART
TSP1	3796	3849	1.99e-13	SMART
TSP1	3854	3906	2.51e-10	SMART
Pfam:TIL	3909	3964	3.4e-11	PFAM
VWC	3966	4022	1.26e0	SMART
TSP1	4009	4059	4.05e-5	SMART
TSP1	4103	4155	3.19e-12	SMART
TSP1	4161	4213	2.87e-2	SMART
TSP1	4218	4269	1.45e-6	SMART
Pfam:TIL	4273	4328	2.1e-10	PFAM
TSP1	4468	4516	7.56e-5	SMART
low complexity region	4551	4562	N/A	INTRINSIC
VWC	4578	4652	5.21e-1	SMART
TSP1	4619	4669	3.92e-12	SMART
Pfam:TIL	4671	4725	1.5e-11	PFAM
Pfam:TIL	4777	4835	3.1e-9	PFAM
VWC	4837	4892	1.8e-11	SMART
GHB	4904	4997	1.02e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000169350
AA Change: C1013Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000131401
Gene: ENSMUSG00000029797
AA Change: C1013Y

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
low complexity region	126	135	N/A	INTRINSIC
VWD	185	341	4.36e-28	SMART
C8	390	469	2.3e-10	SMART
Pfam:TIL	472	527	8.6e-13	PFAM
VWC	529	571	2e-1	SMART
VWD	556	716	5.08e-29	SMART
C8	754	826	2.14e-28	SMART
Pfam:TIL	829	882	1.6e-10	PFAM
VWC	979	1047	4.76e-2	SMART
VWD	1006	1165	9.59e-48	SMART
C8	1201	1275	3.62e-26	SMART
Pfam:TIL	1278	1334	7e-13	PFAM
LDLa	1378	1416	2.29e-13	SMART
LDLa	1418	1453	1.87e-9	SMART
LDLa	1454	1491	5.77e-10	SMART
LDLa	1494	1533	1.52e-9	SMART
LDLa	1567	1604	2.55e-11	SMART
LDLa	1605	1645	5.6e-8	SMART
LDLa	1658	1699	2.29e-4	SMART
TSP1	1700	1751	6.47e-13	SMART
TSP1	1756	1811	1.35e-10	SMART
Pfam:TIL	1815	1871	8.3e-9	PFAM
VWC	1873	1928	2.42e-1	SMART
TSP1	1915	1968	6.94e-2	SMART
VWC	1970	2027	4.95e-9	SMART
low complexity region	2042	2052	N/A	INTRINSIC
FA58C	2069	2226	1.4e-2	SMART
LDLa	2232	2269	1.48e-7	SMART
LDLa	2387	2424	5.68e-9	SMART
LDLa	2444	2481	5.77e-10	SMART
TSP1	2484	2534	1.42e-9	SMART
TSP1	2539	2591	6.36e-21	SMART
Pfam:TIL	2606	2656	1.8e-9	PFAM
VWC	2658	2712	2.48e-1	SMART
TSP1	2699	2750	3.07e-14	SMART
TSP1	2756	2809	4.05e-5	SMART
TSP1	2814	2864	1.83e-12	SMART
EGF_like	2878	2921	5.45e1	SMART
VWC	2928	2981	2.73e-11	SMART
TSP1	2968	3020	3.72e-13	SMART
TSP1	3023	3064	6.05e-4	SMART
Pfam:TIL	3071	3123	3e-11	PFAM
VWC	3125	3180	9.77e-2	SMART
TSP1	3167	3231	6.68e-6	SMART
TSP1	3236	3288	1.08e-14	SMART
Pfam:TIL	3292	3346	6e-9	PFAM
VWC	3348	3405	2.72e-1	SMART
TSP1	3392	3451	3.72e-4	SMART
TSP1	3456	3508	5.27e-4	SMART
Pfam:TIL	3510	3566	1.1e-8	PFAM
TSP1	3629	3674	1.87e-9	SMART
low complexity region	3734	3744	N/A	INTRINSIC
TSP1	3803	3856	5.02e-10	SMART
TSP1	3873	3922	2.95e-7	SMART
TSP1	3939	3992	1.99e-13	SMART
TSP1	3997	4049	2.51e-10	SMART
Pfam:TIL	4052	4107	9.1e-11	PFAM
VWC	4109	4165	1.26e0	SMART
TSP1	4152	4202	4.05e-5	SMART
TSP1	4246	4298	3.19e-12	SMART
TSP1	4304	4356	2.87e-2	SMART
TSP1	4361	4412	1.45e-6	SMART
Pfam:TIL	4416	4471	5.6e-10	PFAM
TSP1	4611	4659	7.56e-5	SMART
low complexity region	4694	4705	N/A	INTRINSIC
VWC	4721	4795	5.21e-1	SMART
TSP1	4762	4812	3.92e-12	SMART
Pfam:TIL	4814	4868	4e-11	PFAM
Pfam:TIL	4920	4978	8.4e-9	PFAM
VWC	4980	5035	1.8e-11	SMART
GHB	5050	5143	1.02e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212740
AA Change: C1013Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.1%
20x: 96.8%

Validation Efficiency

100% (69/69)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp2c1	A	T	9: 105,329,768 (GRCm39)		probably null	Het
Ccdc134	T	A	15: 82,015,990 (GRCm39)		probably benign	Het
Ccdc162	G	T	10: 41,499,410 (GRCm39)	H1066Q	possibly damaging	Het
Ccna1	A	G	3: 54,958,492 (GRCm39)	S64P	probably benign	Het
Cplane1	A	G	15: 8,215,802 (GRCm39)	M453V	probably benign	Het
Defb12	T	C	8: 19,162,837 (GRCm39)		probably null	Het
Dhx9	C	A	1: 153,338,443 (GRCm39)	V738L	probably benign	Het
Dnah10	A	G	5: 124,831,330 (GRCm39)	N843S	probably benign	Het
Dspp	A	G	5: 104,325,122 (GRCm39)	D495G	unknown	Het
Dus2	A	G	8: 106,757,073 (GRCm39)	M88V	probably benign	Het
Dusp13b	A	G	14: 21,791,305 (GRCm39)	V49A	probably benign	Het
Efcab3	A	T	11: 104,889,072 (GRCm39)	I4163L	probably benign	Het
Ehbp1	G	A	11: 22,039,572 (GRCm39)	H843Y	probably null	Het
Entpd3	A	C	9: 120,383,239 (GRCm39)	R91S	probably benign	Het
Fam83c	C	A	2: 155,673,559 (GRCm39)	V210F	probably damaging	Het
Flot1	G	A	17: 36,140,870 (GRCm39)	A287T	probably damaging	Het
Gm19410	A	G	8: 36,273,995 (GRCm39)	K1412E	probably benign	Het
Gsn	G	A	2: 35,182,659 (GRCm39)	V241M	possibly damaging	Het
Gstcd	C	T	3: 132,787,868 (GRCm39)	V277M	probably damaging	Het
Heatr5a	T	C	12: 51,994,779 (GRCm39)	D451G	possibly damaging	Het
Hmcn2	G	A	2: 31,316,915 (GRCm39)	W3831*	probably null	Het
Il3	A	G	11: 54,156,375 (GRCm39)	V119A	probably benign	Het
Jam3	T	C	9: 27,010,156 (GRCm39)	K276R	probably benign	Het
Kcnt1	G	A	2: 25,784,326 (GRCm39)	G277D	possibly damaging	Het
Kif28	T	A	1: 179,527,919 (GRCm39)	D744V	probably damaging	Het
Ldlrad1	G	A	4: 107,066,688 (GRCm39)	A8T	probably benign	Het
Loxhd1	T	C	18: 77,429,709 (GRCm39)	I535T	possibly damaging	Het
Lzts1	A	C	8: 69,588,474 (GRCm39)	L494R	probably benign	Het
Mettl4	A	G	17: 95,042,795 (GRCm39)	V347A	probably damaging	Het
Mff	A	G	1: 82,729,370 (GRCm39)	E270G	probably damaging	Het
Mroh2b	A	T	15: 4,929,985 (GRCm39)	I24F	possibly damaging	Het
Muc16	A	T	9: 18,430,596 (GRCm39)	Y8102*	probably null	Het
Myh14	A	T	7: 44,314,920 (GRCm39)	M1K	probably null	Het
Myo18b	T	A	5: 113,027,376 (GRCm39)		probably benign	Het
Neurl1a	C	A	19: 47,245,873 (GRCm39)	P502T	probably damaging	Het
Nrp1	G	A	8: 129,194,997 (GRCm39)	W484*	probably null	Het
Or2y3	T	A	17: 38,393,452 (GRCm39)	H139L	possibly damaging	Het
Or4f47	T	A	2: 111,972,602 (GRCm39)	I104N	probably benign	Het
Pcdhac1	T	C	18: 37,224,807 (GRCm39)	V540A	possibly damaging	Het
Pcdhga9	A	G	18: 37,870,007 (GRCm39)		probably benign	Het
Pm20d1	A	C	1: 131,729,501 (GRCm39)	N176T	probably benign	Het
Pnldc1	T	C	17: 13,116,189 (GRCm39)	D271G	probably damaging	Het
Pold3	A	G	7: 99,761,508 (GRCm39)	V63A	probably damaging	Het
Rbm18	A	C	2: 36,017,196 (GRCm39)	S61A	probably benign	Het
Rdh14	T	C	12: 10,444,551 (GRCm39)	L134P	probably damaging	Het
Repin1	G	T	6: 48,574,279 (GRCm39)	E403*	probably null	Het
Rtel1	A	G	2: 180,964,138 (GRCm39)	T46A	probably damaging	Het
Rtn3	T	C	19: 7,412,363 (GRCm39)	I823V	probably damaging	Het
S1pr1	A	G	3: 115,505,683 (GRCm39)	S304P	probably damaging	Het
Scfd2	A	G	5: 74,692,024 (GRCm39)	V86A	probably benign	Het
Scgb1a1	C	T	19: 9,062,599 (GRCm39)	V66M	probably damaging	Het
Sec31a	A	T	5: 100,526,721 (GRCm39)	M46K		Het
Sgsm1	A	G	5: 113,403,134 (GRCm39)	M971T	probably damaging	Het
Slc5a11	T	C	7: 122,864,951 (GRCm39)	I419T	probably benign	Het
Slco6d1	A	T	1: 98,394,431 (GRCm39)	T372S	possibly damaging	Het
Slx9	T	C	10: 77,350,229 (GRCm39)	N53S	probably benign	Het
Spata31	T	A	13: 65,068,679 (GRCm39)	Y276N	probably benign	Het
Sprr2k	C	T	3: 92,340,796 (GRCm39)	R49W	unknown	Het
Ssr2	A	G	3: 88,487,190 (GRCm39)	R2G	possibly damaging	Het
St18	C	A	1: 6,898,229 (GRCm39)	T677K	probably benign	Het
Thap11	A	T	8: 106,582,527 (GRCm39)	I179F	probably damaging	Het
Trf	C	A	9: 103,089,130 (GRCm39)	G586C	probably damaging	Het
Umodl1	A	G	17: 31,192,770 (GRCm39)	N299S	probably benign	Het
Xrcc5	C	A	1: 72,351,595 (GRCm39)	A55E	probably damaging	Het

Other mutations in Sspo

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00333:Sspo	APN	6	48,447,387 (GRCm39)	missense	probably benign	0.02
IGL00339:Sspo	APN	6	48,460,680 (GRCm39)	splice site	probably benign
IGL00391:Sspo	APN	6	48,474,320 (GRCm39)	missense	probably damaging	0.96
IGL00433:Sspo	APN	6	48,466,970 (GRCm39)	missense	probably damaging	1.00
IGL00471:Sspo	APN	6	48,475,147 (GRCm39)	splice site	probably benign
IGL00500:Sspo	APN	6	48,474,355 (GRCm39)	nonsense	probably null
IGL00537:Sspo	APN	6	48,475,147 (GRCm39)	splice site	probably benign
IGL00540:Sspo	APN	6	48,475,147 (GRCm39)	splice site	probably benign
IGL01060:Sspo	APN	6	48,426,413 (GRCm39)	nonsense	probably null
IGL01090:Sspo	APN	6	48,467,059 (GRCm39)	missense	probably benign	0.08
IGL01125:Sspo	APN	6	48,469,822 (GRCm39)	missense	probably damaging	1.00
IGL01447:Sspo	APN	6	48,441,600 (GRCm39)	splice site	probably null
IGL01457:Sspo	APN	6	48,475,277 (GRCm39)	missense	probably benign	0.00
IGL01481:Sspo	APN	6	48,425,449 (GRCm39)	missense	probably benign	0.41
IGL01485:Sspo	APN	6	48,455,665 (GRCm39)	missense	probably damaging	1.00
IGL01544:Sspo	APN	6	48,467,953 (GRCm39)	missense	probably damaging	0.99
IGL01575:Sspo	APN	6	48,435,976 (GRCm39)	missense	probably benign	0.01
IGL01589:Sspo	APN	6	48,428,112 (GRCm39)	missense	probably damaging	1.00
IGL01601:Sspo	APN	6	48,463,313 (GRCm39)	missense	probably benign	0.33
IGL01644:Sspo	APN	6	48,429,436 (GRCm39)	missense	probably benign
IGL01659:Sspo	APN	6	48,451,377 (GRCm39)	missense	probably damaging	1.00
IGL01801:Sspo	APN	6	48,434,072 (GRCm39)	missense	probably damaging	1.00
IGL01872:Sspo	APN	6	48,431,623 (GRCm39)	missense	probably damaging	0.99
IGL01874:Sspo	APN	6	48,429,124 (GRCm39)	missense	probably damaging	1.00
IGL01936:Sspo	APN	6	48,452,821 (GRCm39)	missense	probably damaging	1.00
IGL01941:Sspo	APN	6	48,472,116 (GRCm39)	missense	probably benign	0.19
IGL01986:Sspo	APN	6	48,460,237 (GRCm39)	missense	probably benign	0.05
IGL01987:Sspo	APN	6	48,454,558 (GRCm39)	splice site	probably null
IGL02170:Sspo	APN	6	48,444,917 (GRCm39)	missense	possibly damaging	0.76
IGL02192:Sspo	APN	6	48,436,502 (GRCm39)	missense	possibly damaging	0.86
IGL02210:Sspo	APN	6	48,477,426 (GRCm39)	missense	probably damaging	1.00
IGL02225:Sspo	APN	6	48,461,268 (GRCm39)	missense	probably benign	0.09
IGL02280:Sspo	APN	6	48,473,165 (GRCm39)	missense	probably damaging	1.00
IGL02303:Sspo	APN	6	48,461,639 (GRCm39)	missense	possibly damaging	0.52
IGL02397:Sspo	APN	6	48,438,572 (GRCm39)	missense	probably benign	0.35
IGL02451:Sspo	APN	6	48,437,237 (GRCm39)	splice site	probably benign
IGL02500:Sspo	APN	6	48,455,313 (GRCm39)	nonsense	probably null
IGL02519:Sspo	APN	6	48,461,762 (GRCm39)	missense	probably damaging	1.00
IGL02549:Sspo	APN	6	48,428,707 (GRCm39)	missense	possibly damaging	0.81
IGL02562:Sspo	APN	6	48,467,056 (GRCm39)	splice site	probably null
IGL02673:Sspo	APN	6	48,475,709 (GRCm39)	critical splice donor site	probably null
IGL02673:Sspo	APN	6	48,452,794 (GRCm39)	missense	probably damaging	1.00
IGL02719:Sspo	APN	6	48,459,601 (GRCm39)	missense	probably benign	0.39
IGL02793:Sspo	APN	6	48,464,828 (GRCm39)	splice site	probably benign
IGL03003:Sspo	APN	6	48,432,021 (GRCm39)	missense	probably damaging	0.98
IGL03056:Sspo	APN	6	48,447,472 (GRCm39)	missense	probably benign	0.17
IGL03105:Sspo	APN	6	48,450,592 (GRCm39)	splice site	probably benign
IGL03116:Sspo	APN	6	48,471,035 (GRCm39)	missense	probably benign	0.32
IGL03163:Sspo	APN	6	48,461,266 (GRCm39)	missense	probably benign	0.19
IGL03198:Sspo	APN	6	48,454,516 (GRCm39)	missense	probably benign	0.31
IGL03365:Sspo	APN	6	48,436,349 (GRCm39)	missense	possibly damaging	0.82
Barrier	UTSW	6	48,472,146 (GRCm39)	missense	possibly damaging	0.58
R0312_sspo_280	UTSW	6	48,432,335 (GRCm39)	missense	possibly damaging	0.52
R3112_Sspo_731	UTSW	6	48,434,534 (GRCm39)	missense	probably damaging	1.00
R3498_Sspo_650	UTSW	6	48,444,914 (GRCm39)	missense	possibly damaging	0.58
R4180_Sspo_324	UTSW	6	48,475,329 (GRCm39)	critical splice donor site	probably null
spotsylvania	UTSW	6	48,453,505 (GRCm39)	nonsense	probably null
ANU74:Sspo	UTSW	6	48,437,893 (GRCm39)	missense	probably damaging	1.00
IGL02984:Sspo	UTSW	6	48,472,089 (GRCm39)	missense	probably benign	0.33
IGL03052:Sspo	UTSW	6	48,437,387 (GRCm39)	missense	probably damaging	1.00
IGL03134:Sspo	UTSW	6	48,427,999 (GRCm39)	missense	probably benign	0.28
PIT4531001:Sspo	UTSW	6	48,458,173 (GRCm39)	missense	probably benign
R0087:Sspo	UTSW	6	48,454,719 (GRCm39)	missense	probably damaging	1.00
R0122:Sspo	UTSW	6	48,450,910 (GRCm39)	missense	possibly damaging	0.95
R0129:Sspo	UTSW	6	48,432,352 (GRCm39)	missense	probably benign	0.00
R0164:Sspo	UTSW	6	48,471,128 (GRCm39)	splice site	probably benign
R0195:Sspo	UTSW	6	48,463,570 (GRCm39)	missense	probably benign
R0200:Sspo	UTSW	6	48,463,349 (GRCm39)	missense	probably null	0.01
R0201:Sspo	UTSW	6	48,432,686 (GRCm39)	missense	possibly damaging	0.64
R0241:Sspo	UTSW	6	48,438,429 (GRCm39)	missense	possibly damaging	0.82
R0241:Sspo	UTSW	6	48,438,429 (GRCm39)	missense	possibly damaging	0.82
R0243:Sspo	UTSW	6	48,470,120 (GRCm39)	missense	probably damaging	1.00
R0268:Sspo	UTSW	6	48,442,489 (GRCm39)	missense	probably benign	0.26
R0312:Sspo	UTSW	6	48,432,335 (GRCm39)	missense	possibly damaging	0.52
R0449:Sspo	UTSW	6	48,443,674 (GRCm39)	missense	probably damaging	1.00
R0523:Sspo	UTSW	6	48,428,794 (GRCm39)	missense	probably benign	0.20
R0576:Sspo	UTSW	6	48,441,876 (GRCm39)	splice site	probably null
R0671:Sspo	UTSW	6	48,467,325 (GRCm39)	splice site	probably benign
R0828:Sspo	UTSW	6	48,475,668 (GRCm39)	missense	probably damaging	1.00
R0880:Sspo	UTSW	6	48,452,869 (GRCm39)	missense	possibly damaging	0.69
R0903:Sspo	UTSW	6	48,432,242 (GRCm39)	critical splice acceptor site	probably null
R1051:Sspo	UTSW	6	48,468,389 (GRCm39)	nonsense	probably null
R1083:Sspo	UTSW	6	48,447,933 (GRCm39)	missense	possibly damaging	0.91
R1109:Sspo	UTSW	6	48,474,377 (GRCm39)	missense	probably damaging	1.00
R1118:Sspo	UTSW	6	48,436,352 (GRCm39)	missense	probably damaging	0.97
R1256:Sspo	UTSW	6	48,434,573 (GRCm39)	missense	probably damaging	1.00
R1342:Sspo	UTSW	6	48,438,569 (GRCm39)	missense	probably benign	0.07
R1355:Sspo	UTSW	6	48,425,560 (GRCm39)	missense	probably benign	0.41
R1370:Sspo	UTSW	6	48,425,560 (GRCm39)	missense	probably benign	0.41
R1469:Sspo	UTSW	6	48,467,916 (GRCm39)	missense	probably damaging	1.00
R1469:Sspo	UTSW	6	48,467,916 (GRCm39)	missense	probably damaging	1.00
R1476:Sspo	UTSW	6	48,440,334 (GRCm39)	critical splice donor site	probably null
R1566:Sspo	UTSW	6	48,443,804 (GRCm39)	critical splice donor site	probably null
R1630:Sspo	UTSW	6	48,434,658 (GRCm39)	missense	probably benign	0.01
R1686:Sspo	UTSW	6	48,437,334 (GRCm39)	missense	probably benign	0.00
R1707:Sspo	UTSW	6	48,454,811 (GRCm39)	missense	probably damaging	0.99
R1727:Sspo	UTSW	6	48,471,782 (GRCm39)	missense	probably damaging	1.00
R1822:Sspo	UTSW	6	48,469,820 (GRCm39)	missense	possibly damaging	0.75
R1831:Sspo	UTSW	6	48,466,720 (GRCm39)	missense	probably damaging	1.00
R1835:Sspo	UTSW	6	48,434,274 (GRCm39)	missense	probably damaging	0.97
R1862:Sspo	UTSW	6	48,467,940 (GRCm39)	missense	probably damaging	0.98
R1878:Sspo	UTSW	6	48,436,300 (GRCm39)	missense	possibly damaging	0.92
R1900:Sspo	UTSW	6	48,436,284 (GRCm39)	missense	probably benign	0.22
R1945:Sspo	UTSW	6	48,466,707 (GRCm39)	missense	possibly damaging	0.93
R1957:Sspo	UTSW	6	48,455,207 (GRCm39)	missense	probably damaging	0.99
R1990:Sspo	UTSW	6	48,427,984 (GRCm39)	missense	probably benign	0.00
R1996:Sspo	UTSW	6	48,452,424 (GRCm39)	missense	possibly damaging	0.50
R2049:Sspo	UTSW	6	48,440,465 (GRCm39)	missense	probably benign	0.36
R2049:Sspo	UTSW	6	48,437,697 (GRCm39)	splice site	probably benign
R2064:Sspo	UTSW	6	48,450,596 (GRCm39)	missense	probably damaging	0.99
R2072:Sspo	UTSW	6	48,450,451 (GRCm39)	missense	probably benign	0.01
R2096:Sspo	UTSW	6	48,438,608 (GRCm39)	missense	probably benign
R2106:Sspo	UTSW	6	48,443,250 (GRCm39)	missense	possibly damaging	0.96
R2230:Sspo	UTSW	6	48,477,437 (GRCm39)	missense	probably benign	0.11
R2230:Sspo	UTSW	6	48,425,606 (GRCm39)	missense	probably damaging	0.97
R2232:Sspo	UTSW	6	48,425,606 (GRCm39)	missense	probably damaging	0.97
R2351:Sspo	UTSW	6	48,441,803 (GRCm39)	missense	probably damaging	1.00
R2423:Sspo	UTSW	6	48,430,989 (GRCm39)	missense	probably benign	0.00
R2508:Sspo	UTSW	6	48,441,298 (GRCm39)	missense	probably damaging	1.00
R3110:Sspo	UTSW	6	48,434,534 (GRCm39)	missense	probably damaging	1.00
R3112:Sspo	UTSW	6	48,434,534 (GRCm39)	missense	probably damaging	1.00
R3413:Sspo	UTSW	6	48,457,631 (GRCm39)	missense	probably damaging	1.00
R3433:Sspo	UTSW	6	48,452,885 (GRCm39)	splice site	probably null
R3498:Sspo	UTSW	6	48,444,914 (GRCm39)	missense	possibly damaging	0.58
R3732:Sspo	UTSW	6	48,426,864 (GRCm39)	missense	probably damaging	1.00
R3816:Sspo	UTSW	6	48,458,037 (GRCm39)	missense	possibly damaging	0.77
R3818:Sspo	UTSW	6	48,458,037 (GRCm39)	missense	possibly damaging	0.77
R3819:Sspo	UTSW	6	48,458,037 (GRCm39)	missense	possibly damaging	0.77
R3838:Sspo	UTSW	6	48,457,754 (GRCm39)	missense	probably damaging	1.00
R3850:Sspo	UTSW	6	48,469,424 (GRCm39)	missense	probably damaging	1.00
R3880:Sspo	UTSW	6	48,471,874 (GRCm39)	missense	probably benign	0.38
R3893:Sspo	UTSW	6	48,453,505 (GRCm39)	nonsense	probably null
R4116:Sspo	UTSW	6	48,433,928 (GRCm39)	missense	probably damaging	0.99
R4179:Sspo	UTSW	6	48,475,329 (GRCm39)	critical splice donor site	probably null
R4180:Sspo	UTSW	6	48,475,329 (GRCm39)	critical splice donor site	probably null
R4207:Sspo	UTSW	6	48,455,227 (GRCm39)	missense	probably benign	0.00
R4210:Sspo	UTSW	6	48,441,835 (GRCm39)	missense	probably benign	0.00
R4223:Sspo	UTSW	6	48,428,091 (GRCm39)	missense	possibly damaging	0.54
R4224:Sspo	UTSW	6	48,428,091 (GRCm39)	missense	possibly damaging	0.54
R4225:Sspo	UTSW	6	48,428,091 (GRCm39)	missense	possibly damaging	0.54
R4229:Sspo	UTSW	6	48,467,868 (GRCm39)	missense	probably benign	0.00
R4230:Sspo	UTSW	6	48,467,868 (GRCm39)	missense	probably benign	0.00
R4363:Sspo	UTSW	6	48,475,665 (GRCm39)	missense	probably damaging	1.00
R4370:Sspo	UTSW	6	48,443,282 (GRCm39)	missense	probably null	0.14
R4407:Sspo	UTSW	6	48,437,454 (GRCm39)	missense	probably damaging	1.00
R4438:Sspo	UTSW	6	48,464,287 (GRCm39)	missense	probably damaging	1.00
R4454:Sspo	UTSW	6	48,464,159 (GRCm39)	missense	probably benign	0.05
R4455:Sspo	UTSW	6	48,442,450 (GRCm39)	missense	probably damaging	1.00
R4561:Sspo	UTSW	6	48,452,468 (GRCm39)	splice site	probably null
R4574:Sspo	UTSW	6	48,442,457 (GRCm39)	missense	probably damaging	1.00
R4578:Sspo	UTSW	6	48,440,307 (GRCm39)	missense	possibly damaging	0.58
R4653:Sspo	UTSW	6	48,455,580 (GRCm39)	missense	probably damaging	1.00
R4656:Sspo	UTSW	6	48,431,010 (GRCm39)	missense	possibly damaging	0.65
R4659:Sspo	UTSW	6	48,461,147 (GRCm39)	missense	probably damaging	1.00
R4664:Sspo	UTSW	6	48,450,468 (GRCm39)	missense	possibly damaging	0.82
R4685:Sspo	UTSW	6	48,469,828 (GRCm39)	missense	probably damaging	0.98
R4692:Sspo	UTSW	6	48,459,621 (GRCm39)	missense	probably damaging	1.00
R4703:Sspo	UTSW	6	48,477,387 (GRCm39)	missense	probably damaging	1.00
R4704:Sspo	UTSW	6	48,475,638 (GRCm39)	missense	probably damaging	1.00
R4738:Sspo	UTSW	6	48,455,330 (GRCm39)	missense	possibly damaging	0.78
R4766:Sspo	UTSW	6	48,447,514 (GRCm39)	missense	probably benign	0.04
R4771:Sspo	UTSW	6	48,437,813 (GRCm39)	missense	probably damaging	1.00
R4790:Sspo	UTSW	6	48,437,705 (GRCm39)	missense	probably benign	0.04
R4792:Sspo	UTSW	6	48,438,519 (GRCm39)	missense	probably benign	0.00
R4808:Sspo	UTSW	6	48,428,095 (GRCm39)	missense	probably damaging	1.00
R4812:Sspo	UTSW	6	48,467,444 (GRCm39)	missense	probably benign	0.00
R4883:Sspo	UTSW	6	48,437,756 (GRCm39)	missense	probably benign	0.00
R4906:Sspo	UTSW	6	48,442,664 (GRCm39)	critical splice acceptor site	probably null
R4934:Sspo	UTSW	6	48,442,486 (GRCm39)	missense	probably damaging	1.00
R4945:Sspo	UTSW	6	48,444,021 (GRCm39)	splice site	probably null
R4967:Sspo	UTSW	6	48,441,539 (GRCm39)	missense	probably damaging	0.97
R5016:Sspo	UTSW	6	48,429,214 (GRCm39)	nonsense	probably null
R5018:Sspo	UTSW	6	48,432,634 (GRCm39)	missense	probably damaging	1.00
R5034:Sspo	UTSW	6	48,457,757 (GRCm39)	missense	possibly damaging	0.93
R5044:Sspo	UTSW	6	48,443,889 (GRCm39)	critical splice acceptor site	probably null
R5055:Sspo	UTSW	6	48,441,729 (GRCm39)	missense	probably damaging	1.00
R5087:Sspo	UTSW	6	48,465,405 (GRCm39)	missense	possibly damaging	0.51
R5155:Sspo	UTSW	6	48,437,408 (GRCm39)	missense	probably benign	0.03
R5223:Sspo	UTSW	6	48,455,258 (GRCm39)	missense	probably damaging	1.00
R5249:Sspo	UTSW	6	48,470,244 (GRCm39)	missense	probably damaging	0.98
R5257:Sspo	UTSW	6	48,453,428 (GRCm39)	missense	probably damaging	1.00
R5258:Sspo	UTSW	6	48,453,428 (GRCm39)	missense	probably damaging	1.00
R5276:Sspo	UTSW	6	48,467,401 (GRCm39)	missense	probably damaging	1.00
R5307:Sspo	UTSW	6	48,431,784 (GRCm39)	missense	probably damaging	0.99
R5341:Sspo	UTSW	6	48,436,549 (GRCm39)	missense	probably damaging	1.00
R5361:Sspo	UTSW	6	48,443,247 (GRCm39)	missense	probably benign	0.02
R5385:Sspo	UTSW	6	48,439,187 (GRCm39)	missense	probably benign	0.18
R5394:Sspo	UTSW	6	48,472,194 (GRCm39)	missense	possibly damaging	0.52
R5477:Sspo	UTSW	6	48,475,327 (GRCm39)	missense	possibly damaging	0.60
R5490:Sspo	UTSW	6	48,470,214 (GRCm39)	missense	probably benign	0.33
R5512:Sspo	UTSW	6	48,432,605 (GRCm39)	missense	probably damaging	0.97
R5518:Sspo	UTSW	6	48,473,588 (GRCm39)	missense	possibly damaging	0.92
R5530:Sspo	UTSW	6	48,442,517 (GRCm39)	missense	probably damaging	0.97
R5538:Sspo	UTSW	6	48,429,112 (GRCm39)	missense	probably damaging	0.99
R5590:Sspo	UTSW	6	48,451,425 (GRCm39)	missense	probably damaging	1.00
R5613:Sspo	UTSW	6	48,431,978 (GRCm39)	missense	possibly damaging	0.79
R5638:Sspo	UTSW	6	48,469,825 (GRCm39)	missense	possibly damaging	0.86
R5809:Sspo	UTSW	6	48,436,979 (GRCm39)	missense	possibly damaging	0.59
R5810:Sspo	UTSW	6	48,460,832 (GRCm39)	missense	probably benign	0.02
R5814:Sspo	UTSW	6	48,428,818 (GRCm39)	missense	probably damaging	1.00
R5915:Sspo	UTSW	6	48,468,418 (GRCm39)	missense	possibly damaging	0.83
R5915:Sspo	UTSW	6	48,441,530 (GRCm39)	missense	probably benign	0.00
R5979:Sspo	UTSW	6	48,440,627 (GRCm39)	missense	probably benign	0.20
R5996:Sspo	UTSW	6	48,471,110 (GRCm39)	missense	possibly damaging	0.87
R6012:Sspo	UTSW	6	48,428,305 (GRCm39)	missense	probably benign	0.00
R6025:Sspo	UTSW	6	48,463,720 (GRCm39)	missense	possibly damaging	0.83
R6120:Sspo	UTSW	6	48,442,510 (GRCm39)	missense	probably damaging	1.00
R6150:Sspo	UTSW	6	48,463,313 (GRCm39)	missense	probably benign	0.33
R6221:Sspo	UTSW	6	48,440,639 (GRCm39)	missense	probably damaging	1.00
R6261:Sspo	UTSW	6	48,439,125 (GRCm39)	missense	possibly damaging	0.75
R6312:Sspo	UTSW	6	48,434,300 (GRCm39)	critical splice donor site	probably null
R6372:Sspo	UTSW	6	48,449,475 (GRCm39)	missense	probably damaging	1.00
R6456:Sspo	UTSW	6	48,428,740 (GRCm39)	missense	probably benign	0.08
R6497:Sspo	UTSW	6	48,472,142 (GRCm39)	missense	possibly damaging	0.71
R6501:Sspo	UTSW	6	48,472,146 (GRCm39)	missense	possibly damaging	0.58
R6617:Sspo	UTSW	6	48,467,980 (GRCm39)	missense	possibly damaging	0.93
R6825:Sspo	UTSW	6	48,442,459 (GRCm39)	missense	probably benign	0.04
R6831:Sspo	UTSW	6	48,461,767 (GRCm39)	missense	possibly damaging	0.68
R6861:Sspo	UTSW	6	48,464,889 (GRCm39)	missense	probably benign	0.15
R6961:Sspo	UTSW	6	48,440,811 (GRCm39)	missense	probably benign	0.05
R6967:Sspo	UTSW	6	48,466,728 (GRCm39)	missense	probably benign	0.21
R7016:Sspo	UTSW	6	48,426,098 (GRCm39)	missense	probably damaging	1.00
R7035:Sspo	UTSW	6	48,426,147 (GRCm39)	splice site	probably null
R7058:Sspo	UTSW	6	48,425,516 (GRCm39)	missense	probably damaging	1.00
R7072:Sspo	UTSW	6	48,431,913 (GRCm39)	missense	probably damaging	1.00
R7078:Sspo	UTSW	6	48,437,313 (GRCm39)	missense	probably damaging	1.00
R7082:Sspo	UTSW	6	48,455,543 (GRCm39)	critical splice acceptor site	probably null
R7120:Sspo	UTSW	6	48,442,505 (GRCm39)	missense	probably benign	0.05
R7127:Sspo	UTSW	6	48,426,446 (GRCm39)	missense	probably benign	0.02
R7146:Sspo	UTSW	6	48,478,029 (GRCm39)	missense	probably benign	0.15
R7220:Sspo	UTSW	6	48,453,540 (GRCm39)	nonsense	probably null
R7242:Sspo	UTSW	6	48,450,886 (GRCm39)	missense	probably benign
R7261:Sspo	UTSW	6	48,427,011 (GRCm39)	missense	possibly damaging	0.52
R7313:Sspo	UTSW	6	48,450,390 (GRCm39)	missense	probably benign	0.04
R7313:Sspo	UTSW	6	48,431,762 (GRCm39)	missense	probably damaging	1.00
R7323:Sspo	UTSW	6	48,438,581 (GRCm39)	missense	possibly damaging	0.93
R7330:Sspo	UTSW	6	48,452,396 (GRCm39)	missense	probably benign	0.00
R7351:Sspo	UTSW	6	48,441,855 (GRCm39)	missense	possibly damaging	0.89
R7467:Sspo	UTSW	6	48,463,237 (GRCm39)	missense	probably damaging	1.00
R7475:Sspo	UTSW	6	48,432,794 (GRCm39)	missense	probably benign	0.37
R7489:Sspo	UTSW	6	48,450,647 (GRCm39)	missense	probably damaging	0.99
R7508:Sspo	UTSW	6	48,443,633 (GRCm39)	missense	probably damaging	1.00
R7515:Sspo	UTSW	6	48,470,820 (GRCm39)	missense	probably damaging	1.00
R7564:Sspo	UTSW	6	48,426,434 (GRCm39)	missense	probably benign	0.04
R7607:Sspo	UTSW	6	48,466,661 (GRCm39)	missense	probably damaging	1.00
R7620:Sspo	UTSW	6	48,444,020 (GRCm39)	critical splice donor site	probably null
R7667:Sspo	UTSW	6	48,452,305 (GRCm39)	nonsense	probably null
R7691:Sspo	UTSW	6	48,461,163 (GRCm39)	missense	probably benign	0.12
R7707:Sspo	UTSW	6	48,438,461 (GRCm39)	missense	probably benign	0.01
R7723:Sspo	UTSW	6	48,441,572 (GRCm39)	missense	probably damaging	0.99
R7748:Sspo	UTSW	6	48,426,399 (GRCm39)	nonsense	probably null
R7767:Sspo	UTSW	6	48,428,316 (GRCm39)	missense	probably damaging	0.96
R7792:Sspo	UTSW	6	48,431,624 (GRCm39)	missense	probably damaging	0.98
R7878:Sspo	UTSW	6	48,469,460 (GRCm39)	missense	probably damaging	1.00
R7893:Sspo	UTSW	6	48,440,244 (GRCm39)	missense	probably benign	0.02
R7942:Sspo	UTSW	6	48,465,434 (GRCm39)	splice site	probably null
R7952:Sspo	UTSW	6	48,464,263 (GRCm39)	missense	probably damaging	1.00
R7981:Sspo	UTSW	6	48,445,428 (GRCm39)	missense	probably benign
R7995:Sspo	UTSW	6	48,469,823 (GRCm39)	missense	probably damaging	1.00
R8129:Sspo	UTSW	6	48,443,959 (GRCm39)	missense	possibly damaging	0.79
R8145:Sspo	UTSW	6	48,444,683 (GRCm39)	missense	possibly damaging	0.49
R8202:Sspo	UTSW	6	48,434,534 (GRCm39)	missense	probably damaging	1.00
R8211:Sspo	UTSW	6	48,469,543 (GRCm39)	critical splice donor site	probably null
R8240:Sspo	UTSW	6	48,460,436 (GRCm39)	missense	possibly damaging	0.84
R8252:Sspo	UTSW	6	48,462,386 (GRCm39)	missense	probably damaging	0.99
R8270:Sspo	UTSW	6	48,426,897 (GRCm39)	missense	probably benign
R8272:Sspo	UTSW	6	48,425,453 (GRCm39)	missense	probably benign	0.03
R8316:Sspo	UTSW	6	48,459,622 (GRCm39)	missense	probably damaging	1.00
R8384:Sspo	UTSW	6	48,459,598 (GRCm39)	missense	probably damaging	1.00
R8390:Sspo	UTSW	6	48,444,896 (GRCm39)	missense	probably benign	0.00
R8770:Sspo	UTSW	6	48,451,206 (GRCm39)	missense	probably null	1.00
R8827:Sspo	UTSW	6	48,434,606 (GRCm39)	missense	possibly damaging	0.59
R8882:Sspo	UTSW	6	48,452,390 (GRCm39)	missense	probably damaging	1.00
R8886:Sspo	UTSW	6	48,458,201 (GRCm39)	missense	possibly damaging	0.92
R8946:Sspo	UTSW	6	48,434,071 (GRCm39)	missense	probably damaging	1.00
R8947:Sspo	UTSW	6	48,425,504 (GRCm39)	missense	probably damaging	1.00
R9028:Sspo	UTSW	6	48,473,087 (GRCm39)	missense	probably benign	0.38
R9043:Sspo	UTSW	6	48,470,214 (GRCm39)	missense	probably benign	0.07
R9056:Sspo	UTSW	6	48,450,608 (GRCm39)	missense	probably damaging	0.97
R9071:Sspo	UTSW	6	48,433,982 (GRCm39)	missense	probably benign	0.00
R9133:Sspo	UTSW	6	48,434,747 (GRCm39)	missense	possibly damaging	0.81
R9187:Sspo	UTSW	6	48,472,223 (GRCm39)	missense	probably damaging	1.00
R9205:Sspo	UTSW	6	48,432,806 (GRCm39)	missense	probably benign	0.03
R9213:Sspo	UTSW	6	48,440,869 (GRCm39)	missense	possibly damaging	0.91
R9214:Sspo	UTSW	6	48,440,869 (GRCm39)	missense	possibly damaging	0.91
R9215:Sspo	UTSW	6	48,440,869 (GRCm39)	missense	possibly damaging	0.91
R9235:Sspo	UTSW	6	48,466,718 (GRCm39)	missense	probably damaging	1.00
R9254:Sspo	UTSW	6	48,464,928 (GRCm39)	missense	probably damaging	1.00
R9291:Sspo	UTSW	6	48,473,330 (GRCm39)	missense	probably damaging	1.00
R9312:Sspo	UTSW	6	48,445,396 (GRCm39)	missense	probably benign	0.00
R9357:Sspo	UTSW	6	48,443,989 (GRCm39)	missense	possibly damaging	0.77
R9480:Sspo	UTSW	6	48,470,820 (GRCm39)	missense	probably damaging	1.00
R9586:Sspo	UTSW	6	48,458,039 (GRCm39)	missense	probably benign	0.03
R9660:Sspo	UTSW	6	48,432,707 (GRCm39)	missense	probably damaging	1.00
R9661:Sspo	UTSW	6	48,455,272 (GRCm39)	nonsense	probably null
R9728:Sspo	UTSW	6	48,432,707 (GRCm39)	missense	probably damaging	1.00
R9776:Sspo	UTSW	6	48,439,269 (GRCm39)	missense	probably benign	0.00
RF009:Sspo	UTSW	6	48,436,919 (GRCm39)	nonsense	probably null
X0060:Sspo	UTSW	6	48,457,728 (GRCm39)	missense	probably damaging	1.00
X0060:Sspo	UTSW	6	48,443,228 (GRCm39)	missense	probably damaging	1.00
X0063:Sspo	UTSW	6	48,474,356 (GRCm39)	missense	probably damaging	0.96
X0065:Sspo	UTSW	6	48,438,618 (GRCm39)	missense	probably benign	0.00
Z1176:Sspo	UTSW	6	48,458,227 (GRCm39)	missense	probably damaging	1.00
Z1177:Sspo	UTSW	6	48,467,824 (GRCm39)	missense	probably damaging	1.00
Z1177:Sspo	UTSW	6	48,467,482 (GRCm39)	nonsense	probably null
Z1177:Sspo	UTSW	6	48,450,369 (GRCm39)	missense	probably damaging	0.99
Z1177:Sspo	UTSW	6	48,447,918 (GRCm39)	missense	probably benign	0.16
Z1177:Sspo	UTSW	6	48,441,750 (GRCm39)	missense	possibly damaging	0.72
Z1177:Sspo	UTSW	6	48,433,960 (GRCm39)	missense	probably benign	0.31
Z1186:Sspo	UTSW	6	48,445,441 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTACCATATGACCTTGTGACCC -3'
(R):5'- ACGCCTTGGTACATGTGAGG -3'

Sequencing Primer
(F):5'- CTCTTCACTACAAGGGGTTAAAATGG -3'
(R):5'- GGTACATGTGAGGCCACTG -3'

Posted On

2020-09-18