Incidental Mutation 'R8134:Spaca1'
ID651988
Institutional Source Beutler Lab
Gene Symbol Spaca1
Ensembl Gene ENSMUSG00000028264
Gene Namesperm acrosome associated 1
Synonyms1700124L11Rik, 4930540L03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8134 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location34024874-34050191 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 34042157 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734] [ENSMUST00000108148]
Predicted Effect probably null
Transcript: ENSMUST00000029927
SMART Domains Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000084734
SMART Domains Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108148
SMART Domains Protein: ENSMUSP00000103783
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
transmembrane domain 109 131 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 79,699,353 P265L probably benign Het
Adam20 A G 8: 40,796,064 T404A probably benign Het
Anp32a G T 9: 62,377,581 R237L unknown Het
Ascc3 A G 10: 50,767,458 D1835G probably benign Het
Atg9b A G 5: 24,385,222 probably null Het
Bard1 A T 1: 71,067,138 N443K probably damaging Het
Btnl1 A G 17: 34,385,673 D476G possibly damaging Het
C2cd3 A T 7: 100,418,504 I487F Het
Cadm4 A G 7: 24,503,605 E384G possibly damaging Het
Camsap3 A G 8: 3,598,075 K128E probably benign Het
Casz1 C T 4: 148,943,035 P1005S probably damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Cdk20 A G 13: 64,437,920 E244G probably benign Het
Cfap54 A T 10: 92,878,516 V2667D unknown Het
Col11a1 A G 3: 114,218,786 K1792E unknown Het
Cpne9 A T 6: 113,295,042 D377V probably benign Het
Csmd1 A T 8: 15,932,550 C2706S probably damaging Het
Ctnnbl1 T C 2: 157,809,471 V222A probably benign Het
Frmpd2 T C 14: 33,505,495 S277P probably benign Het
Gm15922 A G 7: 3,735,839 S590P probably damaging Het
Herc2 C T 7: 56,085,136 T158I probably benign Het
Hoxa4 G T 6: 52,190,557 H215N possibly damaging Het
Hpd G T 5: 123,174,380 Q309K probably benign Het
Il20ra A G 10: 19,750,704 T159A probably damaging Het
Ints10 T A 8: 68,802,986 Y209* probably null Het
Ints2 A G 11: 86,212,660 I1190T probably damaging Het
Jhy A G 9: 40,960,892 V107A probably null Het
Kdm4d C T 9: 14,463,236 R442H probably damaging Het
Kif1bp T C 10: 62,577,977 Y134C probably benign Het
Klb A T 5: 65,383,615 H1017L probably benign Het
Kndc1 T A 7: 139,901,369 probably null Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,627,834 probably benign Het
Lrrn3 T C 12: 41,453,048 I423M probably damaging Het
Magi2 T G 5: 20,391,367 F274L probably damaging Het
Magi2 T A 5: 20,391,394 D283E probably benign Het
Map3k19 A C 1: 127,823,755 S620A probably damaging Het
Meis2 C T 2: 115,866,888 M388I probably benign Het
Ms4a3 G C 19: 11,638,249 H54Q probably benign Het
Nfe2l1 A T 11: 96,819,759 M548K possibly damaging Het
Ninl C T 2: 150,950,314 C763Y probably benign Het
Numa1 T C 7: 102,001,627 F1522L probably benign Het
Olfr1344 T C 7: 6,438,923 probably benign Het
Olfr539 T A 7: 140,667,767 I153N possibly damaging Het
Pcdhgc3 G A 18: 37,806,863 V106I probably benign Het
Phf3 A G 1: 30,824,471 V152A unknown Het
Plcg2 A T 8: 117,557,318 D118V probably damaging Het
Pnpla1 A G 17: 28,878,469 D203G probably damaging Het
Ppip5k2 A T 1: 97,745,163 M474K probably benign Het
Ppp1r12b T C 1: 134,886,542 E341G possibly damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rrs1 C T 1: 9,545,420 probably benign Het
Scaf11 T C 15: 96,420,711 N324S probably damaging Het
Sun3 G T 11: 9,029,346 D118E probably benign Het
Svop C T 5: 114,042,931 V215I probably benign Het
Tbc1d15 A T 10: 115,209,569 C497S probably damaging Het
Tdrd6 A T 17: 43,626,173 I1328N probably damaging Het
Tuba8 T A 6: 121,221,422 D116E probably benign Het
Ube2z A G 11: 96,058,374 I213T possibly damaging Het
Ubqln4 G A 3: 88,555,490 probably null Het
Vps13a A G 19: 16,654,354 I2639T possibly damaging Het
Zfp217 G A 2: 170,119,651 S252F possibly damaging Het
Zfp94 A T 7: 24,303,741 V92E probably benign Het
Other mutations in Spaca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spaca1 APN 4 34029077 missense probably damaging 0.99
IGL01871:Spaca1 APN 4 34040894 missense probably damaging 0.98
F5770:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
FR4342:Spaca1 UTSW 4 34049838 small insertion probably benign
FR4548:Spaca1 UTSW 4 34049856 small insertion probably benign
FR4737:Spaca1 UTSW 4 34049836 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049844 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049849 small insertion probably benign
R0377:Spaca1 UTSW 4 34044267 splice site probably null
R1861:Spaca1 UTSW 4 34044206 missense probably damaging 0.99
R3105:Spaca1 UTSW 4 34028468 missense probably damaging 1.00
R4930:Spaca1 UTSW 4 34044236 missense possibly damaging 0.65
R5030:Spaca1 UTSW 4 34039247 missense possibly damaging 0.65
R5137:Spaca1 UTSW 4 34029095 missense probably damaging 1.00
R5264:Spaca1 UTSW 4 34049863 missense possibly damaging 0.53
R6158:Spaca1 UTSW 4 34029176 missense probably damaging 0.99
R6824:Spaca1 UTSW 4 34049869 missense probably benign 0.00
R8039:Spaca1 UTSW 4 34044207 missense probably damaging 0.99
R8094:Spaca1 UTSW 4 34049837 missense possibly damaging 0.55
RF006:Spaca1 UTSW 4 34049853 small insertion probably benign
RF017:Spaca1 UTSW 4 34049853 small insertion probably benign
RF032:Spaca1 UTSW 4 34049854 small insertion probably benign
RF043:Spaca1 UTSW 4 34049846 small insertion probably benign
RF044:Spaca1 UTSW 4 34049846 small insertion probably benign
RF044:Spaca1 UTSW 4 34049854 small insertion probably benign
RF060:Spaca1 UTSW 4 34049841 small insertion probably benign
V7580:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7581:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7582:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7583:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACACTTGGATTCACCTCCAGG -3'
(R):5'- CCCAACTCTGAAAATTTCCATGATC -3'

Sequencing Primer
(F):5'- TGGATTCACCTCCAGGGCATC -3'
(R):5'- TTATTGGCTTTAGGAAGCATA -3'
Posted On2020-09-18