Incidental Mutation 'R8134:Kndc1'
ID 651990
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, VKIND, very-kind, 2410012C07Rik
MMRRC Submission 067562-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8134 (G1)
Quality Score 191.009
Status Validated
Chromosome 7
Chromosomal Location 139474612-139521450 bp(+) (GRCm39)
Type of Mutation splice site (69 bp from exon)
DNA Base Change (assembly) T to A at 139481285 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445] [ENSMUST00000121839]
AlphaFold Q0KK55
Predicted Effect probably null
Transcript: ENSMUST00000053445
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121839
SMART Domains Protein: ENSMUSP00000113856
Gene: ENSMUSG00000066129

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
low complexity region 455 465 N/A INTRINSIC
Blast:KIND 466 539 7e-32 BLAST
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.5%
  • 20x: 93.5%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abce1 G A 8: 80,425,982 (GRCm39) P265L probably benign Het
Adam20 A G 8: 41,249,101 (GRCm39) T404A probably benign Het
Anp32a G T 9: 62,284,863 (GRCm39) R237L unknown Het
Ascc3 A G 10: 50,643,554 (GRCm39) D1835G probably benign Het
Atg9b A G 5: 24,590,220 (GRCm39) probably null Het
Bard1 A T 1: 71,106,297 (GRCm39) N443K probably damaging Het
Btnl1 A G 17: 34,604,647 (GRCm39) D476G possibly damaging Het
C2cd3 A T 7: 100,067,711 (GRCm39) I487F Het
Cadm4 A G 7: 24,203,030 (GRCm39) E384G possibly damaging Het
Camsap3 A G 8: 3,648,075 (GRCm39) K128E probably benign Het
Casz1 C T 4: 149,027,492 (GRCm39) P1005S probably damaging Het
Cd38 C A 5: 44,058,790 (GRCm39) L135M probably damaging Het
Cdk20 A G 13: 64,585,734 (GRCm39) E244G probably benign Het
Cfap54 A T 10: 92,714,378 (GRCm39) V2667D unknown Het
Col11a1 A G 3: 114,012,435 (GRCm39) K1792E unknown Het
Cpne9 A T 6: 113,272,003 (GRCm39) D377V probably benign Het
Csmd1 A T 8: 15,982,550 (GRCm39) C2706S probably damaging Het
Ctnnbl1 T C 2: 157,651,391 (GRCm39) V222A probably benign Het
Frmpd2 T C 14: 33,227,452 (GRCm39) S277P probably benign Het
Herc2 C T 7: 55,734,884 (GRCm39) T158I probably benign Het
Hoxa4 G T 6: 52,167,537 (GRCm39) H215N possibly damaging Het
Hpd G T 5: 123,312,443 (GRCm39) Q309K probably benign Het
Il20ra A G 10: 19,626,452 (GRCm39) T159A probably damaging Het
Ints10 T A 8: 69,255,638 (GRCm39) Y209* probably null Het
Ints2 A G 11: 86,103,486 (GRCm39) I1190T probably damaging Het
Jhy A G 9: 40,872,188 (GRCm39) V107A probably null Het
Kdm4d C T 9: 14,374,532 (GRCm39) R442H probably damaging Het
Kifbp T C 10: 62,413,756 (GRCm39) Y134C probably benign Het
Klb A T 5: 65,540,958 (GRCm39) H1017L probably benign Het
Krtap4-1 GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC 11: 99,518,660 (GRCm39) probably benign Het
Lrrn3 T C 12: 41,503,047 (GRCm39) I423M probably damaging Het
Magi2 T G 5: 20,596,365 (GRCm39) F274L probably damaging Het
Magi2 T A 5: 20,596,392 (GRCm39) D283E probably benign Het
Map3k19 A C 1: 127,751,492 (GRCm39) S620A probably damaging Het
Meis2 C T 2: 115,697,369 (GRCm39) M388I probably benign Het
Ms4a3 G C 19: 11,615,613 (GRCm39) H54Q probably benign Het
Nfe2l1 A T 11: 96,710,585 (GRCm39) M548K possibly damaging Het
Ninl C T 2: 150,792,234 (GRCm39) C763Y probably benign Het
Numa1 T C 7: 101,650,834 (GRCm39) F1522L probably benign Het
Or13a25 T A 7: 140,247,680 (GRCm39) I153N possibly damaging Het
Or2bd2 T C 7: 6,441,922 (GRCm39) probably benign Het
Pcdhgc3 G A 18: 37,939,916 (GRCm39) V106I probably benign Het
Phf3 A G 1: 30,863,552 (GRCm39) V152A unknown Het
Pira1 A G 7: 3,738,838 (GRCm39) S590P probably damaging Het
Plcg2 A T 8: 118,284,057 (GRCm39) D118V probably damaging Het
Pnpla1 A G 17: 29,097,443 (GRCm39) D203G probably damaging Het
Ppip5k2 A T 1: 97,672,888 (GRCm39) M474K probably benign Het
Ppp1r12b T C 1: 134,814,280 (GRCm39) E341G possibly damaging Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Rrs1 C T 1: 9,615,645 (GRCm39) probably benign Het
Scaf11 T C 15: 96,318,592 (GRCm39) N324S probably damaging Het
Spaca1 T A 4: 34,042,157 (GRCm39) probably null Het
Sun3 G T 11: 8,979,346 (GRCm39) D118E probably benign Het
Svop C T 5: 114,180,992 (GRCm39) V215I probably benign Het
Tbc1d15 A T 10: 115,045,474 (GRCm39) C497S probably damaging Het
Tdrd6 A T 17: 43,937,064 (GRCm39) I1328N probably damaging Het
Tuba8 T A 6: 121,198,381 (GRCm39) D116E probably benign Het
Ube2z A G 11: 95,949,200 (GRCm39) I213T possibly damaging Het
Ubqln4 G A 3: 88,462,797 (GRCm39) probably null Het
Vps13a A G 19: 16,631,718 (GRCm39) I2639T possibly damaging Het
Zfp217 G A 2: 169,961,571 (GRCm39) S252F possibly damaging Het
Zfp94 A T 7: 24,003,166 (GRCm39) V92E probably benign Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139,481,904 (GRCm39) splice site probably benign
IGL01061:Kndc1 APN 7 139,502,610 (GRCm39) missense probably benign 0.00
IGL01099:Kndc1 APN 7 139,500,700 (GRCm39) missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139,493,888 (GRCm39) splice site probably benign
IGL01767:Kndc1 APN 7 139,509,959 (GRCm39) missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139,494,110 (GRCm39) missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139,503,705 (GRCm39) missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139,500,683 (GRCm39) missense probably benign 0.19
IGL02411:Kndc1 APN 7 139,501,829 (GRCm39) critical splice donor site probably null
IGL02472:Kndc1 APN 7 139,490,817 (GRCm39) missense probably benign 0.01
IGL02537:Kndc1 APN 7 139,490,326 (GRCm39) missense probably benign 0.01
IGL02708:Kndc1 APN 7 139,481,097 (GRCm39) missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139,501,425 (GRCm39) missense probably benign 0.28
IGL03160:Kndc1 APN 7 139,500,605 (GRCm39) nonsense probably null
IGL03138:Kndc1 UTSW 7 139,519,791 (GRCm39) missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139,503,692 (GRCm39) frame shift probably null
PIT4696001:Kndc1 UTSW 7 139,512,830 (GRCm39) missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139,490,220 (GRCm39) missense probably benign 0.00
R0384:Kndc1 UTSW 7 139,490,515 (GRCm39) missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139,510,037 (GRCm39) missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139,488,912 (GRCm39) missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139,493,939 (GRCm39) missense probably null 0.19
R0530:Kndc1 UTSW 7 139,481,153 (GRCm39) missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139,503,651 (GRCm39) missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139,502,600 (GRCm39) missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139,507,321 (GRCm39) missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139,510,669 (GRCm39) missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139,507,624 (GRCm39) missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139,501,196 (GRCm39) missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139,510,674 (GRCm39) missense probably benign 0.02
R2103:Kndc1 UTSW 7 139,501,150 (GRCm39) missense probably benign 0.01
R2128:Kndc1 UTSW 7 139,510,025 (GRCm39) missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139,501,738 (GRCm39) missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139,481,123 (GRCm39) missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139,481,976 (GRCm39) splice site probably benign
R3747:Kndc1 UTSW 7 139,507,817 (GRCm39) critical splice donor site probably null
R3848:Kndc1 UTSW 7 139,488,893 (GRCm39) missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139,509,941 (GRCm39) missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4044:Kndc1 UTSW 7 139,504,044 (GRCm39) missense probably benign 0.06
R4095:Kndc1 UTSW 7 139,516,938 (GRCm39) missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139,490,798 (GRCm39) missense probably benign 0.01
R4478:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139,490,202 (GRCm39) missense probably benign 0.00
R4540:Kndc1 UTSW 7 139,501,343 (GRCm39) nonsense probably null
R4584:Kndc1 UTSW 7 139,481,159 (GRCm39) missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139,501,695 (GRCm39) missense probably benign 0.02
R4705:Kndc1 UTSW 7 139,510,036 (GRCm39) missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139,503,946 (GRCm39) nonsense probably null
R4859:Kndc1 UTSW 7 139,501,821 (GRCm39) missense probably benign 0.03
R5004:Kndc1 UTSW 7 139,512,792 (GRCm39) nonsense probably null
R5037:Kndc1 UTSW 7 139,490,371 (GRCm39) missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139,516,722 (GRCm39) missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139,488,878 (GRCm39) missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139,511,802 (GRCm39) missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139,507,804 (GRCm39) missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139,504,026 (GRCm39) missense probably benign 0.00
R5888:Kndc1 UTSW 7 139,475,133 (GRCm39) missense probably benign 0.00
R5942:Kndc1 UTSW 7 139,516,792 (GRCm39) missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139,519,740 (GRCm39) missense probably benign 0.05
R5990:Kndc1 UTSW 7 139,507,333 (GRCm39) missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R6076:Kndc1 UTSW 7 139,481,954 (GRCm39) missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139,503,717 (GRCm39) missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139,501,129 (GRCm39) missense probably benign 0.04
R6276:Kndc1 UTSW 7 139,500,979 (GRCm39) missense probably benign
R6367:Kndc1 UTSW 7 139,493,422 (GRCm39) missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139,502,667 (GRCm39) critical splice donor site probably null
R6745:Kndc1 UTSW 7 139,500,892 (GRCm39) missense probably benign 0.02
R6886:Kndc1 UTSW 7 139,493,485 (GRCm39) missense probably benign 0.01
R6912:Kndc1 UTSW 7 139,490,194 (GRCm39) missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139,501,744 (GRCm39) missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139,516,749 (GRCm39) missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139,511,773 (GRCm39) missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139,500,699 (GRCm39) missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139,488,959 (GRCm39) missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139,500,612 (GRCm39) missense probably benign 0.01
R7570:Kndc1 UTSW 7 139,503,691 (GRCm39) frame shift probably null
R7625:Kndc1 UTSW 7 139,517,930 (GRCm39) missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139,475,176 (GRCm39) missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139,519,751 (GRCm39) missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139,503,731 (GRCm39) missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139,500,880 (GRCm39) missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139,501,402 (GRCm39) missense probably benign 0.02
R8011:Kndc1 UTSW 7 139,490,536 (GRCm39) missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139,498,760 (GRCm39) missense probably benign 0.01
R8197:Kndc1 UTSW 7 139,493,447 (GRCm39) missense probably damaging 1.00
R8350:Kndc1 UTSW 7 139,503,960 (GRCm39) missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139,493,434 (GRCm39) missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139,481,121 (GRCm39) missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139,503,669 (GRCm39) missense probably benign 0.27
R8735:Kndc1 UTSW 7 139,490,130 (GRCm39) missense probably benign 0.00
R8816:Kndc1 UTSW 7 139,517,909 (GRCm39) missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139,503,976 (GRCm39) missense possibly damaging 0.95
R9002:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139,507,708 (GRCm39) missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139,501,357 (GRCm39) missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139,500,600 (GRCm39) missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139,475,140 (GRCm39) missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139,501,392 (GRCm39) missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9510:Kndc1 UTSW 7 139,510,031 (GRCm39) missense probably benign 0.00
R9518:Kndc1 UTSW 7 139,519,827 (GRCm39) missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139,500,620 (GRCm39) missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139,501,828 (GRCm39) missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139,490,729 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAGAGTGCAGCCTGTCCATG -3'
(R):5'- GGCATCCTGTTATTATGAGGAAGG -3'

Sequencing Primer
(F):5'- CTGTCCATGCGGAGTGTC -3'
(R):5'- TCTGAATAGAGCTCAGAATTGTGGC -3'
Posted On 2020-09-18