Incidental Mutation 'R8243:Dnajc8'
ID651997
Institutional Source Beutler Lab
Gene Symbol Dnajc8
Ensembl Gene ENSMUSG00000054405
Gene NameDnaJ heat shock protein family (Hsp40) member C8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8243 (G1)
Quality Score104.008
Status Validated
Chromosome4
Chromosomal Location132535550-132553742 bp(+) (GRCm38)
Type of Mutationsplice site (996 bp from exon)
DNA Base Change (assembly) A to G at 132551464 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000067467] [ENSMUST00000094657] [ENSMUST00000105939] [ENSMUST00000105940] [ENSMUST00000138334] [ENSMUST00000139074]
Predicted Effect probably benign
Transcript: ENSMUST00000067467
SMART Domains Protein: ENSMUSP00000068069
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
SCOP:d1repc1 23 79 4e-5 SMART
Blast:DnaJ 56 79 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000094657
SMART Domains Protein: ENSMUSP00000092242
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 115 2.65e-18 SMART
low complexity region 135 146 N/A INTRINSIC
coiled coil region 164 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105939
SMART Domains Protein: ENSMUSP00000101559
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 22 81 2.09e-16 SMART
low complexity region 101 112 N/A INTRINSIC
coiled coil region 130 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105940
SMART Domains Protein: ENSMUSP00000101560
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 96 2.15e-1 SMART
low complexity region 116 127 N/A INTRINSIC
coiled coil region 145 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138334
SMART Domains Protein: ENSMUSP00000130135
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
DnaJ 38 84 4.42e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139074
Predicted Effect probably null
Transcript: ENSMUST00000150207
SMART Domains Protein: ENSMUSP00000121009
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
DnaJ 32 91 2.65e-18 SMART
low complexity region 111 122 N/A INTRINSIC
low complexity region 178 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156385
SMART Domains Protein: ENSMUSP00000125885
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
coiled coil region 23 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.5%
  • 10x: 98.7%
  • 20x: 96.0%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam19 T A 11: 46,125,082 H356Q probably damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcl6 C T 16: 23,968,133 C636Y probably damaging Het
Cabyr G T 18: 12,750,702 C82F probably benign Het
Clec4a1 T C 6: 122,924,819 V70A possibly damaging Het
Col11a1 C T 3: 114,061,492 P134S unknown Het
Col27a1 A G 4: 63,225,883 T603A probably damaging Het
Col6a6 T C 9: 105,699,269 D1964G probably damaging Het
Diexf T C 1: 193,114,629 D598G probably benign Het
E330034G19Rik T C 14: 24,308,292 Y318H Het
Efemp1 T A 11: 28,921,690 S402T probably damaging Het
Emcn T C 3: 137,391,650 V110A possibly damaging Het
Fgd5 C T 6: 91,989,023 L746F possibly damaging Het
Gna13 A G 11: 109,396,413 N354S probably damaging Het
Helq G T 5: 100,770,482 S855R possibly damaging Het
Hps5 G T 7: 46,786,642 A160E probably damaging Het
Igfbp7 T A 5: 77,401,492 E188V probably benign Het
Ivd A G 2: 118,871,537 Y150C probably damaging Het
Jade2 T C 11: 51,817,218 T723A probably benign Het
Kif1b T C 4: 149,204,267 N1239S probably benign Het
Klb A G 5: 65,378,995 N556S possibly damaging Het
Klhdc8a C T 1: 132,302,566 R140C possibly damaging Het
Klhl2 T A 8: 64,749,050 M531L probably benign Het
Mark3 T A 12: 111,647,522 S546R possibly damaging Het
Mfsd8 G A 3: 40,835,193 R140C probably damaging Het
Musk G A 4: 58,293,600 R63K probably benign Het
Nacad C T 11: 6,602,643 E183K probably damaging Het
Oasl1 T C 5: 114,928,161 Y113H probably benign Het
Olfr1216 T A 2: 89,013,707 Y119F probably benign Het
Olfr54 C T 11: 51,027,311 T103M probably benign Het
Olfr613 A T 7: 103,551,998 D71V probably damaging Het
Olfr923 A G 9: 38,828,507 E272G Het
Olfr980 A T 9: 40,006,188 C254S probably benign Het
P4hb T C 11: 120,563,380 D296G probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Plekhh1 G A 12: 79,079,069 R1293H probably benign Het
Prss21 A G 17: 23,869,402 T114A probably damaging Het
Ptprn T C 1: 75,252,535 D776G probably damaging Het
Rffl A G 11: 82,812,795 C101R probably damaging Het
Rundc1 A G 11: 101,425,558 D152G probably benign Het
Sema6c A G 3: 95,172,605 T737A probably damaging Het
Sppl2c A G 11: 104,187,861 T496A probably damaging Het
Supt7l T C 5: 31,515,669 I412V probably benign Het
Trim38 T A 13: 23,791,395 I439N probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Usp18 G A 6: 121,269,144 R353H probably benign Het
Usp42 T C 5: 143,715,094 K1058R probably benign Het
Other mutations in Dnajc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03211:Dnajc8 APN 4 132544737 missense possibly damaging 0.95
pith UTSW 4 132544720 missense probably damaging 0.98
R2130:Dnajc8 UTSW 4 132544059 missense possibly damaging 0.95
R3077:Dnajc8 UTSW 4 132544663 missense probably damaging 1.00
R5621:Dnajc8 UTSW 4 132553252 unclassified probably benign
R6921:Dnajc8 UTSW 4 132544720 missense probably damaging 0.98
R6925:Dnajc8 UTSW 4 132544113 missense probably damaging 0.99
R7255:Dnajc8 UTSW 4 132551573 missense probably benign 0.20
R8054:Dnajc8 UTSW 4 132544757 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCAGCCATGACTGTTACAC -3'
(R):5'- GTCTAGAATGACCCACCTCAG -3'

Sequencing Primer
(F):5'- TGTTACACAGAGAAACAAGAAAGAAG -3'
(R):5'- AGCTCCTCGCCTCAGAC -3'
Posted On2020-09-18