Incidental Mutation 'R8124:Obox3'
ID652014
Institutional Source Beutler Lab
Gene Symbol Obox3
Ensembl Gene ENSMUSG00000066772
Gene Nameoocyte specific homeobox 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R8124 (G1)
Quality Score150.008
Status Not validated
Chromosome7
Chromosomal Location15479825-15639902 bp(-) (GRCm38)
Type of Mutationsplice site (35745 bp from exon)
DNA Base Change (assembly) A to T at 15589949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000083291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086122]
Predicted Effect probably null
Transcript: ENSMUST00000086122
SMART Domains Protein: ENSMUSP00000083291
Gene: ENSMUSG00000066772

DomainStartEndE-ValueType
HOX 94 156 1.84e-16 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.6%
  • 10x: 98.6%
  • 20x: 94.5%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agap3 T A 5: 24,478,130 I320N probably benign Het
Ahnak G A 19: 9,007,123 G1924S probably damaging Het
Ap2a2 G A 7: 141,598,844 R141H probably benign Het
Atf7ip2 T C 16: 10,209,135 V89A possibly damaging Het
Clpsl2 G A 17: 28,550,728 G55R probably damaging Het
Csnk2a2 G A 8: 95,455,947 P296L Het
Dab2 T A 15: 6,429,397 C263* probably null Het
Dao AGG AG 5: 114,015,209 probably benign Het
Ddx60 C T 8: 61,983,911 A965V probably benign Het
Dennd5a A T 7: 109,897,935 I1119N probably damaging Het
Dpy30 A G 17: 74,316,104 probably benign Het
Epg5 G A 18: 77,964,996 A780T probably benign Het
Etl4 A G 2: 20,806,640 D1546G probably benign Het
Evl C T 12: 108,681,524 R295* probably null Het
F13a1 T C 13: 37,025,805 K62R probably damaging Het
Gm2832 T C 14: 41,278,937 M44T Het
Gm884 A G 11: 103,620,431 V237A unknown Het
Gm9195 T C 14: 72,442,623 I2249V probably benign Het
Hmcn2 T C 2: 31,400,124 V2323A probably benign Het
Ice2 T A 9: 69,400,495 N20K probably damaging Het
Klf15 T C 6: 90,466,881 F146S probably damaging Het
Lgi3 A G 14: 70,534,738 Y241C probably damaging Het
Lig4 A T 8: 9,972,954 D275E probably damaging Het
Lrit1 T A 14: 37,062,048 S444R probably benign Het
Mip T C 10: 128,226,201 V107A possibly damaging Het
Myo15 G A 11: 60,507,453 V1581M Het
Nckap1l A G 15: 103,473,821 D481G possibly damaging Het
Olfr1438-ps1 T A 19: 12,333,470 N129Y probably damaging Het
Olfr491 C A 7: 108,317,777 N294K possibly damaging Het
Olfr707 G A 7: 106,891,881 T76I possibly damaging Het
Olfr749 C T 14: 50,736,286 R292H probably benign Het
Olfr944 T C 9: 39,217,671 F105L probably benign Het
Papd7 G A 13: 69,533,597 probably benign Het
Pilrb2 T A 5: 137,871,044 E98V probably damaging Het
Plekhm1 A G 11: 103,366,949 V1053A probably benign Het
Prdm2 A T 4: 143,135,265 V485E probably damaging Het
Riox2 G A 16: 59,486,591 E282K probably benign Het
Rps6ka2 T A 17: 7,281,829 V379E possibly damaging Het
Skiv2l2 A C 13: 112,927,337 D7E probably benign Het
Slc4a7 G A 14: 14,729,211 E20K possibly damaging Het
Sned1 G A 1: 93,282,989 probably null Het
Spata3 C T 1: 86,024,353 R110C unknown Het
St6gal1 G A 16: 23,357,835 A393T probably benign Het
Tmem132d T C 5: 127,792,560 Q570R probably damaging Het
Tmem87a T C 2: 120,392,195 T168A probably benign Het
Trank1 A G 9: 111,378,927 R1747G probably benign Het
Txk C T 5: 72,703,263 probably null Het
Vcan T A 13: 89,704,254 L862F possibly damaging Het
Wdr64 A T 1: 175,799,278 probably null Het
Zfp106 G T 2: 120,524,331 Q1343K probably benign Het
Zfp719 A G 7: 43,589,890 T301A probably benign Het
Other mutations in Obox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Obox3 APN 7 15626852 missense probably benign 0.00
IGL02601:Obox3 APN 7 15626923 missense probably damaging 0.99
IGL02978:Obox3 APN 7 15626253 missense probably benign 0.11
IGL03088:Obox3 APN 7 15627002 splice site probably benign
IGL03178:Obox3 APN 7 15627277 missense probably benign 0.12
IGL03219:Obox3 APN 7 15625878 missense probably damaging 0.99
IGL03373:Obox3 APN 7 15625790 missense probably benign 0.01
R0119:Obox3 UTSW 7 15626327 critical splice acceptor site probably null
R1471:Obox3 UTSW 7 15626950 missense probably benign 0.01
R3916:Obox3 UTSW 7 15627226 missense probably benign 0.00
R4072:Obox3 UTSW 7 15625799 missense possibly damaging 0.92
R4073:Obox3 UTSW 7 15625799 missense possibly damaging 0.92
R4075:Obox3 UTSW 7 15625799 missense possibly damaging 0.92
R4076:Obox3 UTSW 7 15625799 missense possibly damaging 0.92
R4712:Obox3 UTSW 7 15626839 missense probably benign 0.04
R4751:Obox3 UTSW 7 15625692 critical splice donor site probably null
R4868:Obox3 UTSW 7 15627310 missense probably damaging 1.00
R5151:Obox3 UTSW 7 15626248 missense probably damaging 1.00
R5290:Obox3 UTSW 7 15626849 missense probably benign 0.03
R5399:Obox3 UTSW 7 15626288 missense probably benign 0.00
R5882:Obox3 UTSW 7 15626968 missense probably benign 0.17
R6147:Obox3 UTSW 7 15626001 missense probably damaging 0.99
R6378:Obox3 UTSW 7 15626102 missense probably benign 0.00
R7221:Obox3 UTSW 7 15626058 missense probably benign 0.01
R7314:Obox3 UTSW 7 15627154 missense possibly damaging 0.50
Z1176:Obox3 UTSW 7 15626224 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGAGTCCTCTAGTGACCCCAAC -3'
(R):5'- TCAGTAATGCCAGTGCCTTC -3'

Sequencing Primer
(F):5'- CACGTCCACTGCAATCAAGTCATTC -3'
(R):5'- GGTTCTGGCACTGATGAAAATG -3'
Posted On2020-09-23