Incidental Mutation 'R8170:B4galnt3'
ID 652019
Institutional Source Beutler Lab
Gene Symbol B4galnt3
Ensembl Gene ENSMUSG00000041372
Gene Name beta-1,4-N-acetyl-galactosaminyl transferase 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R8170 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 120203073-120294559 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 120206616 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057283] [ENSMUST00000212457]
AlphaFold Q6L8S8
Predicted Effect probably null
Transcript: ENSMUST00000057283
SMART Domains Protein: ENSMUSP00000058253
Gene: ENSMUSG00000041372

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
PA14 129 276 1.16e-21 SMART
low complexity region 591 612 N/A INTRINSIC
Pfam:CHGN 650 985 3.9e-29 PFAM
Pfam:Glyco_transf_7C 896 974 3.3e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000212457
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] B4GALNT3 transfers N-acetylgalactosamine (GalNAc) onto glucosyl residues to form N,N-prime-diacetyllactosediamine (LacdiNAc, or LDN), a unique terminal structure of cell surface N-glycans (Ikehara et al., 2006 [PubMed 16728562]).[supplied by OMIM, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,263,594 V595A probably benign Het
A430033K04Rik A G 5: 138,647,053 E400G possibly damaging Het
Abca16 C T 7: 120,465,782 T554I probably damaging Het
Acadm T A 3: 153,944,398 R10W possibly damaging Het
Arhgef25 A G 10: 127,187,179 W120R probably damaging Het
Atg7 A T 6: 114,701,190 Q347L probably benign Het
Atl2 T C 17: 79,856,261 I316V possibly damaging Het
Baiap2l1 A T 5: 144,277,692 Y397* probably null Het
Cacna1b A G 2: 24,678,874 probably null Het
Capn10 T C 1: 92,934,964 S31P probably damaging Het
Casp8ap2 C T 4: 32,615,490 probably benign Het
Ccdc122 A T 14: 77,091,878 I124L probably benign Het
Ccdc90b A G 7: 92,561,542 S3G probably benign Het
Cdc14b A T 13: 64,215,735 probably null Het
Chd5 T A 4: 152,376,583 M1210K probably benign Het
Clec18a T G 8: 111,080,919 K133T probably damaging Het
Cog4 T A 8: 110,866,031 M413K probably damaging Het
Cpa5 A T 6: 30,624,595 I145L probably benign Het
Ctdspl2 T G 2: 122,006,942 S397A probably benign Het
Dnah8 T A 17: 30,673,823 I794N probably damaging Het
Ednrb T A 14: 103,823,204 T218S possibly damaging Het
Eif3b T A 5: 140,426,775 probably null Het
Fam208b G A 13: 3,574,881 Q1690* probably null Het
Fanci A C 7: 79,433,557 probably null Het
Fat2 C T 11: 55,270,455 V3150M probably damaging Het
Fat3 T C 9: 15,947,496 Y3808C probably damaging Het
Gabrr1 T A 4: 33,162,718 L428Q probably damaging Het
Garnl3 G C 2: 33,015,223 P488R possibly damaging Het
Gli3 T C 13: 15,720,208 S656P probably benign Het
Gm35339 C A 15: 76,363,619 F1614L Het
Gpr153 T C 4: 152,280,177 I230T probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Hoxc6 A G 15: 103,009,861 N86D probably benign Het
Iqch T G 9: 63,429,030 R985S probably damaging Het
Jun T A 4: 95,050,322 N317I probably damaging Het
Kif26a T G 12: 112,175,318 probably null Het
Map4k3 T C 17: 80,605,860 H627R possibly damaging Het
Misp T A 10: 79,826,466 I239N probably benign Het
Mpzl2 T A 9: 45,043,721 V27E probably damaging Het
Mta3 T C 17: 83,791,661 S385P probably damaging Het
Muc5b G A 7: 141,861,000 S2561N unknown Het
Myh8 A G 11: 67,288,266 H495R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp5 A T 7: 23,433,710 T927S probably benign Het
Nr5a2 T A 1: 136,940,647 D310V probably benign Het
Nrbp1 A G 5: 31,245,803 T207A probably damaging Het
Nxf1 G T 19: 8,771,050 L14F probably benign Het
Olfr447 G A 6: 42,912,191 A223T possibly damaging Het
Olfr777 T A 10: 129,269,048 N92Y possibly damaging Het
Pcdhb15 A G 18: 37,475,584 E623G probably damaging Het
Pid1 T C 1: 84,285,000 probably null Het
Plcb2 C A 2: 118,711,453 R892L possibly damaging Het
Polr1a C G 6: 71,920,749 P243A probably benign Het
Pot1a A G 6: 25,758,803 *326Q probably null Het
Ppp5c G T 7: 17,007,146 F335L probably damaging Het
Prl8a2 T C 13: 27,352,811 Y139H probably benign Het
Rogdi G T 16: 5,011,737 R93S probably benign Het
Rsph6a C A 7: 19,057,580 R225S probably damaging Het
Sept8 T C 11: 53,537,857 S408P possibly damaging Het
Sf3a2 T A 10: 80,803,297 probably null Het
Shank3 T C 15: 89,548,840 S1263P possibly damaging Het
Speer4f2 A C 5: 17,374,461 D86A Het
Stard9 T C 2: 120,700,048 F2262S possibly damaging Het
Svep1 T A 4: 58,069,378 I2803F probably benign Het
Taf1c C T 8: 119,602,826 probably null Het
Tepp A T 8: 95,320,058 I120F probably damaging Het
Tfap2a C T 13: 40,719,268 V317I probably benign Het
Thnsl2 T C 6: 71,129,333 T370A probably benign Het
Tmem201 C T 4: 149,718,720 G564S probably benign Het
Ttc41 A C 10: 86,776,166 E1101A probably damaging Het
Ugcg T A 4: 59,211,974 F113L possibly damaging Het
Unc80 G T 1: 66,651,533 V2456L probably benign Het
Vav3 A T 3: 109,424,007 N74I probably damaging Het
Vmn2r25 T A 6: 123,853,017 R58S probably benign Het
Ylpm1 T A 12: 85,034,027 M1499K probably benign Het
Zfp647 A G 15: 76,911,371 V363A possibly damaging Het
Other mutations in B4galnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:B4galnt3 APN 6 120215390 missense possibly damaging 0.87
IGL01543:B4galnt3 APN 6 120209312 missense probably benign 0.00
IGL02692:B4galnt3 APN 6 120210311 missense probably damaging 1.00
IGL03149:B4galnt3 APN 6 120231594 splice site probably benign
IGL03272:B4galnt3 APN 6 120216306 missense probably damaging 1.00
Minimus UTSW 6 120215057 missense probably benign
R0121:B4galnt3 UTSW 6 120215038 missense probably benign
R0414:B4galnt3 UTSW 6 120216565 missense probably benign 0.05
R1885:B4galnt3 UTSW 6 120223640 missense probably damaging 0.99
R1908:B4galnt3 UTSW 6 120210090 critical splice donor site probably null
R2264:B4galnt3 UTSW 6 120203810 makesense probably null
R4208:B4galnt3 UTSW 6 120215102 missense probably damaging 0.99
R4353:B4galnt3 UTSW 6 120215476 missense possibly damaging 0.89
R4649:B4galnt3 UTSW 6 120224620 missense probably damaging 1.00
R4874:B4galnt3 UTSW 6 120207206 missense probably damaging 1.00
R5046:B4galnt3 UTSW 6 120214798 missense probably damaging 1.00
R5232:B4galnt3 UTSW 6 120232988 missense probably damaging 1.00
R5431:B4galnt3 UTSW 6 120218967 missense probably damaging 1.00
R5447:B4galnt3 UTSW 6 120215057 missense probably benign
R5458:B4galnt3 UTSW 6 120210385 missense probably damaging 0.98
R5793:B4galnt3 UTSW 6 120208904 critical splice donor site probably null
R5954:B4galnt3 UTSW 6 120225188 missense possibly damaging 0.88
R5985:B4galnt3 UTSW 6 120210158 missense probably damaging 1.00
R6156:B4galnt3 UTSW 6 120214840 missense probably benign 0.02
R6176:B4galnt3 UTSW 6 120224164 missense probably damaging 1.00
R6207:B4galnt3 UTSW 6 120206614 splice site probably null
R6565:B4galnt3 UTSW 6 120217479 nonsense probably null
R7153:B4galnt3 UTSW 6 120214968 missense probably benign 0.00
R7268:B4galnt3 UTSW 6 120215042 missense possibly damaging 0.92
R7307:B4galnt3 UTSW 6 120215431 missense probably benign 0.00
R7311:B4galnt3 UTSW 6 120215435 nonsense probably null
R7360:B4galnt3 UTSW 6 120232979 nonsense probably null
R7538:B4galnt3 UTSW 6 120294423 nonsense probably null
R7674:B4galnt3 UTSW 6 120215205 missense probably benign 0.01
R7706:B4galnt3 UTSW 6 120218952 missense probably benign 0.16
R7727:B4galnt3 UTSW 6 120225187 missense probably benign 0.03
R8125:B4galnt3 UTSW 6 120224593 missense probably damaging 0.99
R8131:B4galnt3 UTSW 6 120294385 splice site probably null
R9225:B4galnt3 UTSW 6 120218967 missense probably damaging 1.00
R9462:B4galnt3 UTSW 6 120294477 missense probably null 0.38
R9531:B4galnt3 UTSW 6 120203841 missense probably damaging 1.00
R9544:B4galnt3 UTSW 6 120232944 missense probably damaging 1.00
X0028:B4galnt3 UTSW 6 120231552 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCAAAGTTCTGTGGCCCTG -3'
(R):5'- ATCAGCCATGGTCACAGCTATG -3'

Sequencing Primer
(F):5'- CACTGGAGCTCTAGCAGATC -3'
(R):5'- GCCATGGTCACAGCTATGTTTGATC -3'
Posted On 2020-09-23