Incidental Mutation 'R8194:Atg4b'
ID652030
Institutional Source Beutler Lab
Gene Symbol Atg4b
Ensembl Gene ENSMUSG00000026280
Gene Nameautophagy related 4B, cysteine peptidase
Synonyms2510009N07Rik, autophagin 1, Apg4b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R8194 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location93751500-93790610 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 93785972 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 55 (C55*)
Ref Sequence ENSEMBL: ENSMUSP00000139463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027502] [ENSMUST00000185482] [ENSMUST00000186811]
Predicted Effect probably benign
Transcript: ENSMUST00000027502
SMART Domains Protein: ENSMUSP00000027502
Gene: ENSMUSG00000026280

DomainStartEndE-ValueType
Pfam:Peptidase_C54 39 335 4.4e-104 PFAM
low complexity region 375 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185482
SMART Domains Protein: ENSMUSP00000140758
Gene: ENSMUSG00000026280

DomainStartEndE-ValueType
Pfam:Peptidase_C54 36 137 2.3e-39 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186811
AA Change: C55*
SMART Domains Protein: ENSMUSP00000139463
Gene: ENSMUSG00000026280
AA Change: C55*

DomainStartEndE-ValueType
Pfam:Peptidase_C54 2 52 6.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Autophagy is the process by which endogenous proteins and damaged organelles are destroyed intracellularly. Autophagy is postulated to be essential for cell homeostasis and cell remodeling during differentiation, metamorphosis, non-apoptotic cell death, and aging. Reduced levels of autophagy have been described in some malignant tumors, and a role for autophagy in controlling the unregulated cell growth linked to cancer has been proposed. This gene encodes a member of the autophagin protein family. The encoded protein is also designated as a member of the C-54 family of cysteine proteases. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased autophagy, impaired swimming, circling, head tilting, and abnormal utricle, saccular, and otolith morphology. Mice homozygous for another gene trap allele exhibit partial preweaning lethality and impaired motor coordination and learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230046K03Rik A G 10: 83,580,299 I818V possibly damaging Het
Arid4a T A 12: 71,060,115 Y320* probably null Het
Ash1l T A 3: 89,052,755 C2265S probably damaging Het
Cacna1s A T 1: 136,077,692 N405I probably benign Het
Capn11 A T 17: 45,633,399 D526E probably damaging Het
Ccdc188 A G 16: 18,218,380 R71G probably benign Het
Ccser2 G A 14: 36,896,263 R772W probably damaging Het
Cenpf T A 1: 189,682,403 E172D probably benign Het
Cep85 T C 4: 134,134,089 M627V probably null Het
Chd1 G A 17: 17,374,475 probably benign Het
Cnst A G 1: 179,610,194 H441R probably benign Het
Cyp2d11 G T 15: 82,390,437 T313N probably damaging Het
Cyp2g1 A G 7: 26,814,734 N255S possibly damaging Het
Dnah5 A G 15: 28,453,268 D4395G probably damaging Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fcnb C T 2: 28,078,318 S209N possibly damaging Het
Gpsm1 CT CTT 2: 26,327,352 probably null Het
Lama4 A G 10: 39,078,720 S1090G probably damaging Het
Malrd1 A G 2: 15,925,120 D1479G unknown Het
Man2a2 T C 7: 80,361,018 K742E probably benign Het
Mapk8 A T 14: 33,382,284 S392T probably benign Het
Mark3 T C 12: 111,592,683 I53T probably damaging Het
Mcmdc2 A G 1: 9,916,642 I219V probably benign Het
Mlycd A T 8: 119,407,593 E278V probably benign Het
Muc2 G T 7: 141,704,252 C29F Het
Mup20 T C 4: 62,053,484 I77V probably benign Het
Myh3 A G 11: 67,092,002 E849G probably damaging Het
Nedd4 A G 9: 72,686,107 N154S probably damaging Het
Olfr397 A T 11: 73,965,414 I269F probably benign Het
Pcdh7 A T 5: 57,720,336 N411I probably damaging Het
Plekhm1 A G 11: 103,395,060 I183T possibly damaging Het
Prkar2a G A 9: 108,692,511 V19M probably damaging Het
Prss35 T G 9: 86,755,613 N145K possibly damaging Het
Ranbp2 T A 10: 58,455,925 D251E possibly damaging Het
Rnf169 C A 7: 99,926,444 V315F probably damaging Het
Slc32a1 T C 2: 158,613,841 Y139H probably damaging Het
Slc5a2 T C 7: 128,271,156 V522A probably benign Het
Slc6a6 A T 6: 91,740,971 Q297L probably damaging Het
Sos2 A C 12: 69,598,824 Y914D probably damaging Het
Spata1 G T 3: 146,489,859 T32N possibly damaging Het
Srcap C T 7: 127,539,197 R1180C probably damaging Het
St14 A T 9: 31,131,625 M1K probably null Het
Tcaf1 T C 6: 42,675,302 T749A probably benign Het
Tcp1 T C 17: 12,922,734 probably null Het
Tle6 A G 10: 81,591,054 V576A probably damaging Het
Ttc25 G A 11: 100,563,676 G429E probably benign Het
Usp17lc T A 7: 103,418,200 M234K probably benign Het
Zdhhc18 A G 4: 133,613,854 L236P probably damaging Het
Zfp266 T C 9: 20,500,314 D189G probably benign Het
Zfp474 A T 18: 52,639,157 D294V probably damaging Het
Zfp568 T C 7: 30,023,333 F568L probably damaging Het
Zfp93 A G 7: 24,276,054 K488R probably benign Het
Other mutations in Atg4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01832:Atg4b APN 1 93785904 splice site probably benign
IGL01875:Atg4b APN 1 93778310 missense probably damaging 1.00
IGL02884:Atg4b APN 1 93787715 utr 3 prime probably benign
R0050:Atg4b UTSW 1 93787718 utr 3 prime probably benign
R0050:Atg4b UTSW 1 93787718 utr 3 prime probably benign
R0387:Atg4b UTSW 1 93786556 missense probably benign 0.02
R0533:Atg4b UTSW 1 93784910 splice site probably benign
R2382:Atg4b UTSW 1 93784842 missense probably damaging 1.00
R3113:Atg4b UTSW 1 93775704 splice site probably benign
R3730:Atg4b UTSW 1 93768275 missense probably damaging 0.99
R4303:Atg4b UTSW 1 93768262 missense probably benign 0.02
R4612:Atg4b UTSW 1 93786541 missense probably damaging 1.00
R5027:Atg4b UTSW 1 93786575 missense probably benign 0.00
R5048:Atg4b UTSW 1 93775658 missense possibly damaging 0.75
R5427:Atg4b UTSW 1 93775206 missense probably damaging 1.00
R5735:Atg4b UTSW 1 93773797 missense probably damaging 1.00
R7209:Atg4b UTSW 1 93775233 missense probably damaging 1.00
R8214:Atg4b UTSW 1 93784887 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTCCAAATGTGTGAACCAAAG -3'
(R):5'- GCCAGTAGAAACCGCAATGC -3'

Sequencing Primer
(F):5'- TGTGTGAACCAAAGTGCGG -3'
(R):5'- AATGCGAGGTACCCTGCC -3'
Posted On2020-09-23