Mutagenetix > Incidental Mutation

Incidental Mutation 'R8264:Sema3c'

652053

Institutional Source

Beutler Lab

Gene Symbol

Sema3c

Ensembl Gene

ENSMUSG00000028780

Gene Name

sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C

Synonyms

1110036B02Rik, Semae

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8264 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

17574281-17730268 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 17676539 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030568] [ENSMUST00000169603] [ENSMUST00000170181]

AlphaFold

Q62181

Predicted Effect

probably benign
Transcript: ENSMUST00000030568

SMART Domains

Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Sema	54	495	1.16e-200	SMART
PSI	513	565	2.87e-13	SMART
IG	577	662	7.08e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000169603

SMART Domains

Protein: ENSMUSP00000132330
Gene: ENSMUSG00000028780

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:Sema	54	226	9.6e-65	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000170181

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (51/52)

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	A	3: 138,067,782	C911S	probably damaging	Het
Abcc4	T	A	14: 118,594,842	N792I	possibly damaging	Het
Acacb	A	T	5: 114,207,366	H960L	probably benign	Het
Aox1	A	G	1: 58,053,714	T162A	possibly damaging	Het
Cacna1g	T	C	11: 94,473,566	S18G	probably benign	Het
Chfr	T	A	5: 110,152,434	I348N	possibly damaging	Het
Cntln	G	A	4: 85,098,411	R12Q	probably damaging	Het
Cyp2c40	A	G	19: 39,807,527	S136P	possibly damaging	Het
Dnah14	T	A	1: 181,744,792	M2896K	probably damaging	Het
Elp6	A	G	9: 110,319,687	T215A	probably damaging	Het
Esyt2	A	C	12: 116,365,920	Q699H	probably benign	Het
Fam179b	A	G	12: 64,995,556	I1130V	probably benign	Het
Fbxo25	A	G	8: 13,929,393	T204A	possibly damaging	Het
Fhdc1	A	G	3: 84,455,032	S294P	probably damaging	Het
G530012D18Rik	C	G	1: 85,577,214	D113E	unknown	Het
Galnt10	A	G	11: 57,782,206	I463V	probably benign	Het
Glce	A	G	9: 62,060,430	F480L	probably benign	Het
H2-Aa	A	G	17: 34,287,735	V11A	probably benign	Het
Hsd17b4	A	G	18: 50,146,526	T191A	possibly damaging	Het
Itpr3	G	T	17: 27,104,112		silent	Het
Izumo4	G	T	10: 80,702,738	G8V		Het
Klk1b5	T	A	7: 44,220,030	L178H	probably damaging	Het
Lama2	T	C	10: 27,467,222	N85D	probably benign	Het
Liph	A	C	16: 21,983,971	I116R	possibly damaging	Het
Lpar5	T	A	6: 125,081,502	V62D	probably damaging	Het
Map3k19	T	A	1: 127,823,791	I303F		Het
Myo10	G	A	15: 25,800,109	V1424M	probably damaging	Het
Myof	T	G	19: 37,921,433	Q1528P	probably damaging	Het
Ncapd3	T	C	9: 27,094,742		probably benign	Het
Nup214	T	A	2: 31,994,726	Y500N	possibly damaging	Het
Olfr1040	T	C	2: 86,146,194	D180G	probably damaging	Het
Papd4	C	T	13: 93,175,569	G208S	probably damaging	Het
Pappa2	T	C	1: 158,854,973	Y835C	probably damaging	Het
Pcdh18	T	C	3: 49,756,581	E95G	probably damaging	Het
Phf3	A	T	1: 30,831,057	N303K	possibly damaging	Het
Pnn	C	T	12: 59,072,577	H649Y	unknown	Het
Rab11fip1	G	A	8: 27,152,480	Q764*	probably null	Het
Ralgapa2	A	T	2: 146,333,450	M1762K	possibly damaging	Het
Rif1	G	A	2: 52,090,278	A496T	noncoding transcript	Het
Rnase13	A	T	14: 51,922,457	V75D	probably damaging	Het
Sema4c	C	G	1: 36,552,885	G266R	probably damaging	Het
Slfn5	A	T	11: 82,956,550	D87V	probably damaging	Het
Smpd3	T	C	8: 106,264,658	Y421C	probably damaging	Het
Snrnp40	T	C	4: 130,378,074	V188A	probably benign	Het
Srms	A	G	2: 181,212,550	Y75H	probably benign	Het
Tex15	T	C	8: 33,582,362	S2646P	probably benign	Het
Tmem8c	A	G	2: 27,067,856		probably benign	Het
Ttf1	A	G	2: 29,064,677	K18E	possibly damaging	Het
Unc5b	G	T	10: 60,768,334	T827K	probably benign	Het
Zfhx2	T	A	14: 55,065,512	T1672S	possibly damaging	Het

Other mutations in Sema3c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00559:Sema3c	APN	5	17694860	missense	probably damaging	1.00
IGL01528:Sema3c	APN	5	17714415	missense	probably benign
IGL01618:Sema3c	APN	5	17672506	missense	probably damaging	1.00
IGL01730:Sema3c	APN	5	17711436	missense	probably benign	0.01
IGL01762:Sema3c	APN	5	17694851	missense	possibly damaging	0.81
IGL02049:Sema3c	APN	5	17721925	splice site	probably benign
IGL02249:Sema3c	APN	5	17662963	missense	probably damaging	1.00
IGL02657:Sema3c	APN	5	17576868	start codon destroyed	possibly damaging	0.71
IGL02657:Sema3c	APN	5	17662974	missense	probably damaging	1.00
IGL03213:Sema3c	APN	5	17694639	splice site	probably benign
PIT4651001:Sema3c	UTSW	5	17694733	missense	probably benign	0.37
R0031:Sema3c	UTSW	5	17694728	missense	probably damaging	1.00
R0558:Sema3c	UTSW	5	17714415	missense	probably benign	0.00
R0964:Sema3c	UTSW	5	17721909	missense	probably damaging	1.00
R1164:Sema3c	UTSW	5	17678314	missense	probably benign	0.40
R1351:Sema3c	UTSW	5	17678336	missense	possibly damaging	0.60
R1368:Sema3c	UTSW	5	17678332	missense	possibly damaging	0.96
R1480:Sema3c	UTSW	5	17682031	missense	possibly damaging	0.57
R1880:Sema3c	UTSW	5	17727466	nonsense	probably null
R1916:Sema3c	UTSW	5	17727401	missense	probably benign	0.06
R3934:Sema3c	UTSW	5	17681940	missense	probably damaging	0.97
R4284:Sema3c	UTSW	5	17678347	missense	probably benign	0.01
R4449:Sema3c	UTSW	5	17576846	start gained	probably benign
R4545:Sema3c	UTSW	5	17694772	missense	probably benign	0.01
R4546:Sema3c	UTSW	5	17694772	missense	probably benign	0.01
R4660:Sema3c	UTSW	5	17672513	missense	probably damaging	1.00
R4890:Sema3c	UTSW	5	17675159	missense	probably benign	0.00
R4937:Sema3c	UTSW	5	17694686	missense	probably benign	0.01
R5065:Sema3c	UTSW	5	17727617	missense	possibly damaging	0.89
R5145:Sema3c	UTSW	5	17727617	missense	possibly damaging	0.89
R5452:Sema3c	UTSW	5	17717070	critical splice donor site	probably null
R5586:Sema3c	UTSW	5	17711424	missense	probably damaging	0.99
R5811:Sema3c	UTSW	5	17675190	splice site	probably null
R5886:Sema3c	UTSW	5	17681986	missense	possibly damaging	0.90
R6120:Sema3c	UTSW	5	17727632	missense	probably benign	0.00
R6191:Sema3c	UTSW	5	17653806	missense	probably damaging	1.00
R6318:Sema3c	UTSW	5	17672432	missense	probably damaging	0.96
R6416:Sema3c	UTSW	5	17576961	missense	probably damaging	0.99
R6441:Sema3c	UTSW	5	17724132	missense	possibly damaging	0.96
R6816:Sema3c	UTSW	5	17670465	missense	probably benign	0.36
R7146:Sema3c	UTSW	5	17694703	missense	probably benign	0.22
R7526:Sema3c	UTSW	5	17727596	missense	possibly damaging	0.46
R7832:Sema3c	UTSW	5	17694847	missense	probably damaging	0.99
R8034:Sema3c	UTSW	5	17727482	missense	probably damaging	1.00
R8053:Sema3c	UTSW	5	17655022	missense	probably benign	0.00
R8076:Sema3c	UTSW	5	17727364	missense	probably benign	0.00
R8359:Sema3c	UTSW	5	17653728	missense	possibly damaging	0.56
R8437:Sema3c	UTSW	5	17662938	missense	probably damaging	0.99
R9174:Sema3c	UTSW	5	17663041	critical splice donor site	probably null
R9295:Sema3c	UTSW	5	17727497	missense	probably benign	0.09
R9477:Sema3c	UTSW	5	17716983	missense
R9599:Sema3c	UTSW	5	17714454	critical splice donor site	probably null
R9702:Sema3c	UTSW	5	17653830	missense	probably damaging	1.00
Z1176:Sema3c	UTSW	5	17727519	missense	probably benign	0.04
Z1177:Sema3c	UTSW	5	17717031	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCAAGACTTGTATGCTCAGTCAC -3'
(R):5'- TCACCAAGAAGAACCAAGCTAGG -3'

Sequencing Primer
(F):5'- GACTTGTATGCTCAGTCACAGATG -3'
(R):5'- CAGAAGGATCCTGTTGCAGC -3'

Posted On

2020-09-30