Incidental Mutation 'R8238:Dpyd'
ID 652065
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8238 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 119195193 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177]
AlphaFold Q8CHR6
Predicted Effect probably null
Transcript: ENSMUST00000039177
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 A G 8: 43,650,956 Y551H probably damaging Het
Ak1 T A 2: 32,633,669 V198D probably damaging Het
Alx1 C T 10: 103,022,215 D208N possibly damaging Het
Atp5b T A 10: 128,085,150 I182N possibly damaging Het
Cabp5 T A 7: 13,405,452 M134K probably damaging Het
Camsap2 A T 1: 136,294,026 I227N probably benign Het
Cfap44 G A 16: 44,415,305 probably null Het
Etl4 C T 2: 20,806,531 R1510* probably null Het
Fgr C T 4: 132,997,521 A311V probably damaging Het
Glipr1 C T 10: 111,993,440 probably null Het
Gm10799 A G 2: 104,068,151 F70L probably benign Het
Gm14412 A T 2: 177,315,318 H261Q unknown Het
Hey2 T A 10: 30,840,663 M35L probably benign Het
Hspb7 A G 4: 141,422,546 Y81C probably damaging Het
Ipo5 A T 14: 120,935,240 K570M probably damaging Het
Iqsec1 A T 6: 90,689,930 H404Q probably benign Het
Kif5b T A 18: 6,227,619 Q86L probably damaging Het
Lrrtm4 T A 6: 80,022,685 I360N probably damaging Het
Mup6 T A 4: 60,003,634 V29E probably damaging Het
Ncstn G T 1: 172,072,476 A277E probably damaging Het
Nsun3 A G 16: 62,770,713 V189A probably damaging Het
Oaf C T 9: 43,239,345 D77N probably damaging Het
Olfr545 T C 7: 102,494,620 T52A possibly damaging Het
Olfr60 A C 7: 140,345,890 L33W probably damaging Het
Pard6a A G 8: 105,702,734 D138G probably damaging Het
Ppp4r4 A C 12: 103,590,807 H434P probably benign Het
Sec23b T C 2: 144,564,648 I121T probably benign Het
Slc36a3 C T 11: 55,131,607 V254I probably benign Het
Slc7a14 C A 3: 31,227,151 V337L probably benign Het
Svs1 A G 6: 48,990,041 E641G probably damaging Het
Tdh C T 14: 63,495,724 G206E probably damaging Het
Vmn1r231 T C 17: 20,890,378 T92A probably benign Het
Vmn2r36 T G 7: 7,889,016 H431P probably benign Het
Vmn2r92 G T 17: 18,185,016 M807I probably benign Het
Vps11 T C 9: 44,352,760 T759A probably benign Het
Xdh G T 17: 73,886,417 Q1295K probably benign Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8910:Dpyd UTSW 3 118610518 missense probably benign 0.17
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACACGCAAGCATACCTGG -3'
(R):5'- CATCCAGTAGTGATTGGAGACTC -3'

Sequencing Primer
(F):5'- GCCTGAATGGGTTTCAACTAC -3'
(R):5'- GGAGACTCATAGTTAATTTGTCCTAC -3'
Posted On 2020-10-02