Incidental Mutation 'R8312:Greb1l'
ID 652070
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms mKIAA4095, AK220484
MMRRC Submission 067718-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8312 (G1)
Quality Score 149.008
Status Validated
Chromosome 18
Chromosomal Location 10325177-10562940 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 10511587 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
AlphaFold B9EJV3
Predicted Effect probably benign
Transcript: ENSMUST00000048977
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 T C 12: 84,662,190 (GRCm39) R23G probably damaging Het
Abraxas2 A G 7: 132,478,329 (GRCm39) Y163C probably damaging Het
Acnat1 A T 4: 49,449,142 (GRCm39) L208* probably null Het
Agbl5 A G 5: 31,051,850 (GRCm39) E556G probably damaging Het
Ampd2 C A 3: 107,987,432 (GRCm39) V134L probably benign Het
Arih2 A G 9: 108,521,473 (GRCm39) S2P probably damaging Het
C87436 T A 6: 86,434,813 (GRCm39) L387Q probably damaging Het
Card9 A T 2: 26,247,801 (GRCm39) Y183* probably null Het
Cdk14 T C 5: 4,944,141 (GRCm39) D394G probably benign Het
Cep135 C T 5: 76,784,746 (GRCm39) S947L probably damaging Het
Cfb T C 17: 35,077,121 (GRCm39) K505E probably benign Het
Cnot4 T A 6: 35,000,076 (GRCm39) D708V probably damaging Het
Col16a1 T A 4: 129,948,244 (GRCm39) L281M unknown Het
Col6a3 G T 1: 90,741,412 (GRCm39) D673E possibly damaging Het
Ctdnep1 G A 11: 69,879,527 (GRCm39) S150N probably benign Het
Fanca T A 8: 123,996,549 (GRCm39) probably benign Het
Fras1 T A 5: 96,736,050 (GRCm39) N548K probably benign Het
Gbp2b A G 3: 142,304,812 (GRCm39) M83V probably benign Het
Gbp2b C A 3: 142,304,815 (GRCm39) P84T probably damaging Het
Gli2 A T 1: 118,795,842 (GRCm39) probably benign Het
Grn A C 11: 102,327,073 (GRCm39) K557T probably damaging Het
Hapln1 C T 13: 89,749,563 (GRCm39) A36V probably benign Het
Heg1 C T 16: 33,547,045 (GRCm39) R635W probably benign Het
Hivep1 C A 13: 42,308,653 (GRCm39) Q298K possibly damaging Het
Hmcn1 A G 1: 150,614,515 (GRCm39) I1297T probably damaging Het
Hp1bp3 T A 4: 137,950,750 (GRCm39) probably benign Het
Htr4 C G 18: 62,570,549 (GRCm39) F201L probably damaging Het
Insrr C G 3: 87,707,791 (GRCm39) Q78E possibly damaging Het
Itga6 A T 2: 71,686,297 (GRCm39) M1072L probably benign Het
Kdsr A G 1: 106,675,216 (GRCm39) probably null Het
Klhl7 T C 5: 24,339,965 (GRCm39) I149T probably damaging Het
Lce1l G C 3: 92,757,766 (GRCm39) P31A unknown Het
Mag T C 7: 30,610,894 (GRCm39) Y116C probably damaging Het
Mast2 A G 4: 116,287,683 (GRCm39) S131P probably benign Het
Mlec C A 5: 115,288,266 (GRCm39) probably null Het
Mrap2 G A 9: 87,051,712 (GRCm39) probably null Het
Myo5b A G 18: 74,867,033 (GRCm39) K1395E probably damaging Het
Nipa2 G A 7: 55,583,050 (GRCm39) Q232* probably null Het
Nsd3 C T 8: 26,153,268 (GRCm39) T536M probably damaging Het
Oit3 T C 10: 59,274,632 (GRCm39) N56S probably benign Het
Or10p22 A G 10: 128,826,347 (GRCm39) T189A probably benign Het
Or13c7 A T 4: 43,854,461 (GRCm39) I51F probably benign Het
Or2m13 T C 16: 19,225,987 (GRCm39) M260V probably benign Het
Pax3 C T 1: 78,172,006 (GRCm39) R68Q probably damaging Het
Pcnx2 G T 8: 126,489,589 (GRCm39) H1668Q possibly damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pkd1 A G 17: 24,786,102 (GRCm39) S463G probably benign Het
Plb1 C T 5: 32,485,829 (GRCm39) T871M probably damaging Het
Prdx1 A G 4: 116,556,398 (GRCm39) D182G possibly damaging Het
Prkch T A 12: 73,807,358 (GRCm39) F593I noncoding transcript Het
Psrc1 C T 3: 108,293,673 (GRCm39) P194L probably benign Het
Ptp4a2 A T 4: 129,733,427 (GRCm39) I18L probably benign Het
Samd10 A T 2: 181,238,668 (GRCm39) L153H probably damaging Het
Shc3 T G 13: 51,596,754 (GRCm39) H423P probably damaging Het
Siae A T 9: 37,557,593 (GRCm39) I467F Het
Slc27a5 C T 7: 12,725,214 (GRCm39) R411Q probably damaging Het
Spata24 A G 18: 35,793,861 (GRCm39) I56T probably benign Het
Spns3 G A 11: 72,390,534 (GRCm39) T407M probably damaging Het
Spta1 G A 1: 174,067,777 (GRCm39) C2068Y probably damaging Het
Svs5 C A 2: 164,080,091 (GRCm39) G25W probably damaging Het
Thsd7a T C 6: 12,471,181 (GRCm39) D479G Het
Trhde T C 10: 114,249,192 (GRCm39) Y858C probably damaging Het
Ttn G A 2: 76,781,992 (GRCm39) R1057C unknown Het
Tulp4 G T 17: 6,257,333 (GRCm39) probably null Het
Tyk2 T C 9: 21,026,945 (GRCm39) T613A possibly damaging Het
Ugt2b37 T C 5: 87,390,799 (GRCm39) K356R probably benign Het
Vmn1r39 A G 6: 66,781,841 (GRCm39) V159A noncoding transcript Het
Vps35 A G 8: 86,001,498 (GRCm39) V440A possibly damaging Het
Zmym6 A G 4: 127,017,627 (GRCm39) N1136S probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm39) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm39) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm39) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm39) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm39) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm39) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm39) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm39) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm39) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm39) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm39) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm39) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm39) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm39) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm39) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm39) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm39) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm39) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm39) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm39) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm39) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm39) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm39) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm39) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm39) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm39) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm39) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm39) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm39) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm39) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm39) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm39) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm39) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm39) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm39) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm39) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm39) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm39) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm39) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm39) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm39) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm39) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm39) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm39) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm39) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm39) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm39) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm39) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm39) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm39) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm39) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm39) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm39) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm39) missense probably benign 0.00
R4819:Greb1l UTSW 18 10,458,358 (GRCm39) missense probably damaging 1.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm39) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm39) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm39) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm39) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm39) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm39) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm39) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm39) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm39) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm39) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm39) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm39) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm39) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm39) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm39) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm39) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm39) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm39) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm39) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm39) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm39) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm39) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm39) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm39) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm39) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm39) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm39) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm39) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm39) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm39) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm39) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm39) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm39) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm39) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm39) missense probably damaging 1.00
R8331:Greb1l UTSW 18 10,458,706 (GRCm39) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm39) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm39) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm39) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm39) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm39) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm39) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm39) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm39) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm39) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm39) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm39) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm39) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm39) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm39) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm39) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm39) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm39) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm39) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm39) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm39) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm39) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCAATGGTGACCTTGATGAG -3'
(R):5'- AAAACACTTCGGGTCTGGCC -3'

Sequencing Primer
(F):5'- ACCTTGATGAGTGTGTGTCCCC -3'
(R):5'- CTCAGCTACGTAATGAGTTTGAAGCC -3'
Posted On 2020-10-02