Mutagenetix > Incidental Mutations

Incidental Mutation 'R7889:Fastkd2'

652071

Institutional Source

Beutler Lab

Gene Symbol

Fastkd2

Ensembl Gene

ENSMUSG00000025962

Gene Name

FAST kinase domains 2

Synonyms

2810421I24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7889 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63730614-63754655 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to G at 63735460 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027103 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027103]

Predicted Effect

probably null
Transcript: ENSMUST00000027103

SMART Domains

Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962

Domain	Start	End	E-Value	Type
low complexity region	310	323	N/A	INTRINSIC
Pfam:FAST_1	443	512	2.3e-23	PFAM
low complexity region	546	557	N/A	INTRINSIC
RAP	619	675	1.66e-16	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Angptl3	C	T	4: 99,031,071	L23F	probably benign	Het
Art2a-ps	C	T	7: 101,555,211	S40N	not run	Het
Ash1l	A	G	3: 88,966,038	T43A	probably benign	Het
Atp1a2	G	A	1: 172,278,064		probably null	Het
Azi2	A	G	9: 118,061,915	E336G	probably benign	Het
Cap2	A	G	13: 46,646,575	H419R	probably damaging	Het
Ccdc14	T	A	16: 34,723,836	S903T	probably damaging	Het
Cep72	A	T	13: 74,050,122	S380T	possibly damaging	Het
Clca3a2	C	A	3: 144,810,813	E341*	probably null	Het
Clcnkb	T	G	4: 141,410,604	I294L	probably benign	Het
Cyp2d9	T	A	15: 82,455,826	M350K	probably damaging	Het
Dhx40	T	G	11: 86,798,967	I266L	probably benign	Het
Dnah5	G	T	15: 28,448,414	E4208*	probably null	Het
Ephb2	T	C	4: 136,771,042	N242S	probably damaging	Het
Fam13b	A	T	18: 34,457,691	F478Y	probably benign	Het
Fbxo40	T	A	16: 36,969,650	D366V	probably damaging	Het
Fhod3	A	T	18: 24,770,494	K95M	probably damaging	Het
Foxo3	T	A	10: 42,275,027	Q136L	probably benign	Het
Gadl1	A	T	9: 115,954,815	Q236L	possibly damaging	Het
Galnt13	A	G	2: 55,112,861	D560G	probably benign	Het
Ghsr	A	G	3: 27,372,166	S124G	probably benign	Het
Gkn2	A	G	6: 87,378,286		probably null	Het
Glyctk	T	A	9: 106,156,439	R68W	unknown	Het
Gm10031	G	A	1: 156,525,395	A389T	probably benign	Het
Gm14025	T	C	2: 129,036,994	E1004G	unknown	Het
Gm5157	G	A	7: 21,184,716	P301S	unknown	Het
Hdc	A	T	2: 126,616,210	I64N	probably damaging	Het
Helq	A	T	5: 100,792,561		probably null	Het
Ighv1-43	T	C	12: 114,945,963	Y113C	probably damaging	Het
Ipo9	T	C	1: 135,406,853	T273A	probably benign	Het
Itga4	G	A	2: 79,316,045	V774I	probably benign	Het
Itpr3	T	C	17: 27,116,777	L2287P	probably damaging	Het
Llgl1	T	A	11: 60,707,312	I394N	probably damaging	Het
Mta1	G	A	12: 113,131,688	R487H	probably benign	Het
Neb	T	C	2: 52,147,669	D7049G	probably benign	Het
Nlrp4f	G	A	13: 65,195,018	S271F	probably damaging	Het
Noxo1	A	G	17: 24,699,382	D172G	probably damaging	Het
Nup155	T	A	15: 8,121,507	V347E	probably damaging	Het
Oaf	G	T	9: 43,222,671	A251E	possibly damaging	Het
Pds5b	T	A	5: 150,792,172	F1039I	probably damaging	Het
Pla2g12b	T	A	10: 59,421,240		probably null	Het
Prmt3	A	G	7: 49,787,301	D208G	possibly damaging	Het
Ptcd3	G	A	6: 71,888,608	T441M	probably damaging	Het
Rabl6	A	G	2: 25,584,774		probably null	Het
Shtn1	T	A	19: 59,003,896	I417F	probably damaging	Het
Slc20a2	T	C	8: 22,540,401	S158P	probably damaging	Het
Sltm	C	G	9: 70,586,673	P802R	possibly damaging	Het
Spata5	A	G	3: 37,578,810	D855G	probably benign	Het
Spef2	T	C	15: 9,717,563	Y232C	probably damaging	Het
Stard9	C	T	2: 120,704,461	T3733I	probably benign	Het
Thrap3	A	T	4: 126,178,062	F512L	probably benign	Het
Tmem150c	A	T	5: 100,093,104	I30K	probably damaging	Het
Tnnt1	C	T	7: 4,508,583	A168T	probably damaging	Het
Trak2	A	G	1: 58,918,824	L308P	probably damaging	Het
Trp53i11	T	C	2: 93,198,899	L81P	probably damaging	Het
Usp16	T	C	16: 87,474,584	Y344H	probably benign	Het
Wdr60	T	A	12: 116,255,939	K128*	probably null	Het
Xrcc5	G	T	1: 72,356,826	V593L	probably benign	Het
Zcchc14	A	T	8: 121,604,895	H576Q	unknown	Het
Zfp616	T	A	11: 74,085,445	C847S	probably damaging	Het
Zfp626	A	T	7: 27,819,499	Y635F	probably benign	Het
Zfp799	G	A	17: 32,819,499	R598*	probably null	Het
Zfp831	A	G	2: 174,645,304	K591E	possibly damaging	Het

Other mutations in Fastkd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Fastkd2	APN	1	63737771	splice site	probably benign
IGL01890:Fastkd2	APN	1	63732161	missense	probably benign	0.06
IGL02698:Fastkd2	APN	1	63747999	missense	probably benign	0.01
IGL02992:Fastkd2	APN	1	63737924	splice site	probably benign
IGL03208:Fastkd2	APN	1	63739206	missense	probably damaging	1.00
R0172:Fastkd2	UTSW	1	63732028	missense	possibly damaging	0.78
R0304:Fastkd2	UTSW	1	63752400	missense	possibly damaging	0.46
R0385:Fastkd2	UTSW	1	63737811	missense	probably benign	0.01
R0486:Fastkd2	UTSW	1	63752340	missense	possibly damaging	0.61
R1115:Fastkd2	UTSW	1	63747955	splice site	probably benign
R1468:Fastkd2	UTSW	1	63732226	unclassified	probably benign
R1579:Fastkd2	UTSW	1	63745887	missense	probably null	0.00
R1729:Fastkd2	UTSW	1	63751300	nonsense	probably null
R3937:Fastkd2	UTSW	1	63737836	missense	possibly damaging	0.48
R4326:Fastkd2	UTSW	1	63752357	missense	probably benign	0.07
R4327:Fastkd2	UTSW	1	63752357	missense	probably benign	0.07
R4463:Fastkd2	UTSW	1	63735809	intron	probably benign
R4473:Fastkd2	UTSW	1	63731674	missense	probably damaging	0.97
R4760:Fastkd2	UTSW	1	63745886	missense	probably benign	0.00
R5012:Fastkd2	UTSW	1	63749896	intron	probably benign
R5176:Fastkd2	UTSW	1	63731439	unclassified	probably benign
R5478:Fastkd2	UTSW	1	63739186	missense	probably benign	0.13
R5619:Fastkd2	UTSW	1	63739310	missense	probably benign	0.25
R6893:Fastkd2	UTSW	1	63731794	missense	possibly damaging	0.75
R7038:Fastkd2	UTSW	1	63731873	missense	possibly damaging	0.79
R7049:Fastkd2	UTSW	1	63731850	missense	probably benign	0.04
R7510:Fastkd2	UTSW	1	63737789	missense	possibly damaging	0.83
R7810:Fastkd2	UTSW	1	63731692	missense	possibly damaging	0.61
R8263:Fastkd2	UTSW	1	63731809	missense	probably benign	0.03
R8271:Fastkd2	UTSW	1	63748024	missense	probably benign	0.26
R8321:Fastkd2	UTSW	1	63747979	missense	probably benign	0.00
R8468:Fastkd2	UTSW	1	63731764	missense	probably benign	0.06
R8767:Fastkd2	UTSW	1	63735921	missense	probably benign	0.00
Z1177:Fastkd2	UTSW	1	63734836	critical splice donor site	probably null
Z1177:Fastkd2	UTSW	1	63734837	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCACAGGTTAGTGAGAGTTATGAGG -3'
(R):5'- TTTTGGAAGTGACAGGCCAAAG -3'

Sequencing Primer
(F):5'- GCAAGTAGACCATGTCTG -3'
(R):5'- TGACAGGCCAAAGACAGCTTTTTC -3'

Posted On

2020-10-09