Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Plch1'

652097

Institutional Source

Beutler Lab

Gene Symbol

Plch1

Ensembl Gene

ENSMUSG00000036834

Gene Name

phospholipase C, eta 1

Synonyms

PLCeta1, Plcl3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

63696234-63899472 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 63702626 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]

AlphaFold

Q4KWH5

Predicted Effect

probably benign
Transcript: ENSMUST00000048134

SMART Domains

Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	3	112	2.37e-6	SMART
EFh	128	156	2.41e-4	SMART
EFh	164	193	1.54e-2	SMART
Pfam:EF-hand_like	198	280	2.2e-26	PFAM
PLCXc	281	426	3.13e-71	SMART
low complexity region	440	453	N/A	INTRINSIC
low complexity region	564	581	N/A	INTRINSIC
PLCYc	583	696	3.4e-49	SMART
C2	715	823	5.47e-22	SMART
low complexity region	979	997	N/A	INTRINSIC
low complexity region	1079	1091	N/A	INTRINSIC
low complexity region	1420	1435	N/A	INTRINSIC
low complexity region	1543	1557	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000059973

SMART Domains

Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	1.1e-8	SMART
EFh	146	174	1.1e-6	SMART
EFh	182	211	7.6e-5	SMART
Pfam:EF-hand_like	216	298	4.5e-24	PFAM
PLCXc	299	444	1.6e-73	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	1.7e-51	SMART
C2	733	841	3.7e-24	SMART
low complexity region	1017	1035	N/A	INTRINSIC
low complexity region	1117	1129	N/A	INTRINSIC
low complexity region	1458	1473	N/A	INTRINSIC
low complexity region	1581	1595	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000084105

SMART Domains

Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	2.4e-27	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART
low complexity region	1018	1036	N/A	INTRINSIC
low complexity region	1118	1130	N/A	INTRINSIC
low complexity region	1459	1474	N/A	INTRINSIC
low complexity region	1582	1596	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159676

SMART Domains

Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.8e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000160638

SMART Domains

Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	5.3e-28	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000162269

SMART Domains

Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.7e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175947

SMART Domains

Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.2e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	3.4e-49	SMART
C2	733	841	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000176861

Predicted Effect

probably benign
Transcript: ENSMUST00000177143

SMART Domains

Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834

Domain	Start	End	E-Value	Type
PH	33	142	2.37e-6	SMART
EFh	158	186	2.41e-4	SMART
EFh	194	223	1.54e-2	SMART
Pfam:EF-hand_like	228	310	2.3e-26	PFAM
PLCXc	311	456	3.13e-71	SMART
low complexity region	470	483	N/A	INTRINSIC
low complexity region	594	611	N/A	INTRINSIC
PLCYc	613	726	3.4e-49	SMART
C2	745	853	5.47e-22	SMART
low complexity region	1009	1027	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1450	1465	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Plch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01397:Plch1	APN	3	63731729	splice site	probably null
IGL01542:Plch1	APN	3	63731649	missense	probably damaging	0.99
IGL01999:Plch1	APN	3	63753307	missense	probably damaging	1.00
IGL02153:Plch1	APN	3	63781351	missense	probably damaging	1.00
IGL02203:Plch1	APN	3	63698739	missense	possibly damaging	0.46
IGL02220:Plch1	APN	3	63698961	missense	probably damaging	0.97
IGL02259:Plch1	APN	3	63722749	critical splice donor site	probably null
IGL02268:Plch1	APN	3	63699283	makesense	probably null
IGL02411:Plch1	APN	3	63697756	splice site	probably null
IGL02472:Plch1	APN	3	63701849	missense	probably damaging	1.00
IGL02477:Plch1	APN	3	63753293	missense	probably damaging	1.00
IGL02503:Plch1	APN	3	63697864	missense	probably damaging	1.00
IGL02800:Plch1	APN	3	63698478	missense	probably benign	0.21
IGL03167:Plch1	APN	3	63722744	splice site	probably benign
IGL03182:Plch1	APN	3	63702594	nonsense	probably null
IGL03197:Plch1	APN	3	63753170	missense	probably damaging	1.00
IGL03251:Plch1	APN	3	63784002	missense	possibly damaging	0.93
BB009:Plch1	UTSW	3	63701981	missense	probably benign	0.05
BB019:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R0335:Plch1	UTSW	3	63710978	missense	probably damaging	1.00
R0347:Plch1	UTSW	3	63753316	missense	probably damaging	1.00
R0631:Plch1	UTSW	3	63699219	missense	probably benign	0.23
R0687:Plch1	UTSW	3	63716029	missense	probably damaging	1.00
R0738:Plch1	UTSW	3	63702553	intron	probably benign
R0883:Plch1	UTSW	3	63753256	missense	probably damaging	1.00
R1437:Plch1	UTSW	3	63697533	missense	probably benign	0.37
R1678:Plch1	UTSW	3	63740694	missense	probably damaging	1.00
R1738:Plch1	UTSW	3	63719238	missense	probably benign	0.12
R1929:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R1955:Plch1	UTSW	3	63755267	missense	probably damaging	0.98
R2078:Plch1	UTSW	3	63701943	missense	probably benign	0.01
R2112:Plch1	UTSW	3	63722806	missense	probably damaging	1.00
R2158:Plch1	UTSW	3	63721234	missense	probably benign	0.00
R2165:Plch1	UTSW	3	63698482	missense	probably benign	0.01
R2259:Plch1	UTSW	3	63697977	missense	possibly damaging	0.94
R2271:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R3110:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3112:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3407:Plch1	UTSW	3	63699347	unclassified	probably benign
R3408:Plch1	UTSW	3	63699347	unclassified	probably benign
R3791:Plch1	UTSW	3	63699523	missense	probably benign
R3793:Plch1	UTSW	3	63697831	missense	probably damaging	0.96
R3928:Plch1	UTSW	3	63767623	missense	probably damaging	1.00
R4211:Plch1	UTSW	3	63711219	missense	probably damaging	1.00
R4212:Plch1	UTSW	3	63870759	start gained	probably benign
R4223:Plch1	UTSW	3	63701900	missense	probably damaging	1.00
R4491:Plch1	UTSW	3	63740739	missense	probably damaging	1.00
R4589:Plch1	UTSW	3	63781507	missense	probably damaging	1.00
R4656:Plch1	UTSW	3	63704177	missense	probably damaging	1.00
R4701:Plch1	UTSW	3	63699496	splice site	probably null
R4716:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R4772:Plch1	UTSW	3	63753325	missense	probably damaging	1.00
R4902:Plch1	UTSW	3	63740843	intron	probably benign
R5058:Plch1	UTSW	3	63722781	missense	probably damaging	1.00
R5092:Plch1	UTSW	3	63698710	missense	probably benign	0.02
R5093:Plch1	UTSW	3	63773715	missense	probably damaging	0.99
R5210:Plch1	UTSW	3	63699778	critical splice donor site	probably null
R5368:Plch1	UTSW	3	63701973	missense	possibly damaging	0.82
R5373:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5374:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5501:Plch1	UTSW	3	63707741	missense	probably damaging	1.00
R5606:Plch1	UTSW	3	63740687	missense	probably benign	0.35
R5738:Plch1	UTSW	3	63773655	missense	probably damaging	1.00
R5835:Plch1	UTSW	3	63697522	missense	probably benign
R6106:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6107:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6108:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6110:Plch1	UTSW	3	63698858	missense	possibly damaging	0.62
R6116:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6147:Plch1	UTSW	3	63722881	missense	probably damaging	1.00
R6195:Plch1	UTSW	3	63740789	missense	probably damaging	1.00
R6315:Plch1	UTSW	3	63781390	nonsense	probably null
R6316:Plch1	UTSW	3	63781390	nonsense	probably null
R6317:Plch1	UTSW	3	63781390	nonsense	probably null
R6318:Plch1	UTSW	3	63781390	nonsense	probably null
R6324:Plch1	UTSW	3	63781390	nonsense	probably null
R6325:Plch1	UTSW	3	63781390	nonsense	probably null
R6326:Plch1	UTSW	3	63781390	nonsense	probably null
R6479:Plch1	UTSW	3	63744510	missense	probably benign	0.06
R6544:Plch1	UTSW	3	63850978	missense	probably damaging	1.00
R6767:Plch1	UTSW	3	63755344	missense	probably damaging	1.00
R6829:Plch1	UTSW	3	63697518	missense	probably damaging	0.99
R6891:Plch1	UTSW	3	63698083	missense	probably benign
R6893:Plch1	UTSW	3	63753141	nonsense	probably null
R6921:Plch1	UTSW	3	63707734	missense	possibly damaging	0.90
R7298:Plch1	UTSW	3	63716037	nonsense	probably null
R7396:Plch1	UTSW	3	63698954	missense	probably benign	0.00
R7420:Plch1	UTSW	3	63722857	missense	probably damaging	1.00
R7566:Plch1	UTSW	3	63781242	splice site	probably null
R7572:Plch1	UTSW	3	63740684	missense	possibly damaging	0.89
R7649:Plch1	UTSW	3	63698169	nonsense	probably null
R7696:Plch1	UTSW	3	63755305	missense	probably benign
R7851:Plch1	UTSW	3	63698434	missense	probably damaging	0.99
R7853:Plch1	UTSW	3	63773647	missense	probably benign	0.44
R7932:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R7983:Plch1	UTSW	3	63707743	missense	probably damaging	1.00
R8057:Plch1	UTSW	3	63698136	missense	probably benign
R8066:Plch1	UTSW	3	63711057	nonsense	probably null
R8678:Plch1	UTSW	3	63716047	nonsense	probably null
R8731:Plch1	UTSW	3	63697638	missense	probably benign	0.37
R8739:Plch1	UTSW	3	63870685	missense	possibly damaging	0.66
R8853:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R8875:Plch1	UTSW	3	63710970	missense	probably damaging	1.00
R8945:Plch1	UTSW	3	63731618	missense	probably benign	0.02
R8947:Plch1	UTSW	3	63784126	missense	probably damaging	0.99
R8953:Plch1	UTSW	3	63731705	missense	possibly damaging	0.94
R9065:Plch1	UTSW	3	63767503	missense	probably damaging	1.00
R9068:Plch1	UTSW	3	63704615	missense	probably damaging	1.00
R9188:Plch1	UTSW	3	63731654	missense	probably null	1.00
R9238:Plch1	UTSW	3	63698991	missense	possibly damaging	0.53
R9478:Plch1	UTSW	3	63699404	missense	probably benign	0.01
R9526:Plch1	UTSW	3	63851128	intron	probably benign
R9539:Plch1	UTSW	3	63784006	missense	probably null	0.01
R9634:Plch1	UTSW	3	63697731	missense	probably damaging	1.00
R9643:Plch1	UTSW	3	63753326	missense
R9659:Plch1	UTSW	3	63773715	missense	probably benign	0.17
R9711:Plch1	UTSW	3	63707755	missense	probably damaging	1.00
R9788:Plch1	UTSW	3	63773715	missense	probably benign	0.17
R9799:Plch1	UTSW	3	63698170	missense	possibly damaging	0.89
RF018:Plch1	UTSW	3	63721215	missense	probably damaging	1.00
X0028:Plch1	UTSW	3	63744509	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AACGCATAGGACTTTAGCAGC -3'
(R):5'- CAACGTATGTATGAGTTAGGATGCTC -3'

Sequencing Primer
(F):5'- TTTAGCAGCCTTGAAGCAGC -3'
(R):5'- GGATGCTCATACCATAAAGTGAC -3'

Posted On

2020-10-14