Incidental Mutation 'R8206:Cep63'
ID652099
Institutional Source Beutler Lab
Gene Symbol Cep63
Ensembl Gene ENSMUSG00000032534
Gene Namecentrosomal protein 63
SynonymsD9Mgc48e, CD20R, D9Mgc41, ET2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.581) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location102584588-102626534 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 102621271 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093791] [ENSMUST00000159100] [ENSMUST00000161645] [ENSMUST00000162297] [ENSMUST00000162655]
Predicted Effect probably benign
Transcript: ENSMUST00000093791
SMART Domains Protein: ENSMUSP00000091306
Gene: ENSMUSG00000032534

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:CEP63 76 338 8.1e-112 PFAM
coiled coil region 401 469 N/A INTRINSIC
coiled coil region 492 591 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
coiled coil region 730 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159100
SMART Domains Protein: ENSMUSP00000124836
Gene: ENSMUSG00000032534

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161645
Predicted Effect probably benign
Transcript: ENSMUST00000162297
Predicted Effect probably benign
Transcript: ENSMUST00000162655
SMART Domains Protein: ENSMUSP00000125621
Gene: ENSMUSG00000032534

DomainStartEndE-ValueType
coiled coil region 72 220 N/A INTRINSIC
coiled coil region 243 283 N/A INTRINSIC
coiled coil region 343 411 N/A INTRINSIC
coiled coil region 434 484 N/A INTRINSIC
coiled coil region 510 529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a subunit of the centrosome, the main microtubule-organizing center of the cell. The encoded protein associates with another centrosomal protein, CEP152, to regulate mother-centriole-dependent centriole duplication in dividing cells. Disruption of a similar gene in human has been associated with primary microcephaly (MCPH). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth defects, microcephaly, thin cerebral cortex, mitotic defects and cell death in neural progenitors, decreased oocyte number, small testis, and severely impaired spermatogenesis and meiotic recombination leading to male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Cep63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Cep63 APN 9 102590458 missense possibly damaging 0.88
IGL02378:Cep63 APN 9 102596115 splice site probably benign
IGL02707:Cep63 APN 9 102586981 missense probably damaging 1.00
IGL03273:Cep63 APN 9 102602467 missense probably benign 0.13
R0355:Cep63 UTSW 9 102623560 missense probably benign
R0847:Cep63 UTSW 9 102588758 missense probably benign 0.12
R1276:Cep63 UTSW 9 102588900 missense possibly damaging 0.77
R1398:Cep63 UTSW 9 102603086 splice site probably benign
R1654:Cep63 UTSW 9 102586913 missense possibly damaging 0.87
R1730:Cep63 UTSW 9 102618867 missense possibly damaging 0.93
R1982:Cep63 UTSW 9 102602880 missense probably damaging 0.99
R2359:Cep63 UTSW 9 102594564 missense possibly damaging 0.95
R2890:Cep63 UTSW 9 102618827 missense probably damaging 0.99
R3082:Cep63 UTSW 9 102602497 missense probably benign 0.00
R4725:Cep63 UTSW 9 102590556 intron probably benign
R4761:Cep63 UTSW 9 102587041 intron probably benign
R5200:Cep63 UTSW 9 102598188 missense probably benign 0.22
R5538:Cep63 UTSW 9 102588793 nonsense probably null
R6463:Cep63 UTSW 9 102596155 missense probably benign
R6887:Cep63 UTSW 9 102625927 intron probably benign
R7854:Cep63 UTSW 9 102602998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAATGTGTTCTTTCAGAGACCATC -3'
(R):5'- TTGCTAGGACATGTAGAGATAGGTG -3'

Sequencing Primer
(F):5'- AGAGGACCCAGGTTTGATTCC -3'
(R):5'- TAGGTGCAGTTACAACACACTAGCTG -3'
Posted On2020-10-14