Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Cacna1i'

652101

Institutional Source

Beutler Lab

Gene Symbol

Cacna1i

Ensembl Gene

ENSMUSG00000022416

Gene Name

calcium channel, voltage-dependent, alpha 1I subunit

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80287238-80398279 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to A at 80389815 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]

AlphaFold

E9Q7P2

Predicted Effect

silent
Transcript: ENSMUST00000160175

SMART Domains

Protein: ENSMUSP00000123881
Gene: ENSMUSG00000022416

Domain	Start	End	E-Value	Type
low complexity region	7	23	N/A	INTRINSIC
low complexity region	93	104	N/A	INTRINSIC
low complexity region	127	143	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000160424

SMART Domains

Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	76	407	1.4e-79	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	597	830	7.4e-58	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1128	1401	7.8e-65	PFAM
Pfam:Ion_trans	1445	1700	9.4e-58	PFAM
Pfam:PKD_channel	1538	1694	1.4e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC
low complexity region	1837	1853	N/A	INTRINSIC
low complexity region	1922	1933	N/A	INTRINSIC
low complexity region	1990	2005	N/A	INTRINSIC
low complexity region	2041	2058	N/A	INTRINSIC
low complexity region	2087	2097	N/A	INTRINSIC
low complexity region	2103	2126	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000161863

SMART Domains

Protein: ENSMUSP00000124367
Gene: ENSMUSG00000022416

Domain	Start	End	E-Value	Type
low complexity region	7	23	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	114	130	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000162025

SMART Domains

Protein: ENSMUSP00000125530
Gene: ENSMUSG00000022416

Domain	Start	End	E-Value	Type
low complexity region	7	23	N/A	INTRINSIC
low complexity region	87	103	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000162155

SMART Domains

Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	115	395	1.9e-66	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	632	819	2.4e-45	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1165	1389	6.2e-55	PFAM
coiled coil region	1394	1426	N/A	INTRINSIC
Pfam:Ion_trans	1480	1688	1.9e-47	PFAM
Pfam:PKD_channel	1538	1694	4.8e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000162913

SMART Domains

Protein: ENSMUSP00000125617
Gene: ENSMUSG00000022416

Domain	Start	End	E-Value	Type
low complexity region	7	23	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Cacna1i

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Cacna1i	APN	15	80382019	missense	probably damaging	1.00
IGL00976:Cacna1i	APN	15	80355645	missense	probably benign
IGL01338:Cacna1i	APN	15	80348380	missense	probably damaging	0.99
IGL01589:Cacna1i	APN	15	80387759	splice site	probably benign
IGL01669:Cacna1i	APN	15	80391757	missense	probably benign
IGL01807:Cacna1i	APN	15	80374147	missense	probably damaging	1.00
IGL01911:Cacna1i	APN	15	80391732	missense	probably benign	0.09
IGL01973:Cacna1i	APN	15	80382033	missense	probably damaging	1.00
IGL02205:Cacna1i	APN	15	80372951	missense	probably benign	0.06
IGL02519:Cacna1i	APN	15	80361874	nonsense	probably null
IGL02648:Cacna1i	APN	15	80298638	missense	probably damaging	0.96
IGL03033:Cacna1i	APN	15	80362239	missense	probably damaging	0.98
IGL03214:Cacna1i	APN	15	80355716	missense	probably benign	0.30
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0295:Cacna1i	UTSW	15	80356211	missense	probably damaging	1.00
R0345:Cacna1i	UTSW	15	80372462	missense	probably damaging	0.98
R0415:Cacna1i	UTSW	15	80368830	splice site	probably benign
R0637:Cacna1i	UTSW	15	80372654	missense	probably damaging	0.99
R0638:Cacna1i	UTSW	15	80381080	missense	possibly damaging	0.94
R0840:Cacna1i	UTSW	15	80358949	missense	possibly damaging	0.85
R1463:Cacna1i	UTSW	15	80379054	missense	possibly damaging	0.96
R1528:Cacna1i	UTSW	15	80391774	splice site	probably null
R1563:Cacna1i	UTSW	15	80321188	missense	probably damaging	0.97
R1563:Cacna1i	UTSW	15	80389855	splice site	probably benign
R1573:Cacna1i	UTSW	15	80393668	splice site	probably null
R1654:Cacna1i	UTSW	15	80389210	missense	probably damaging	1.00
R1754:Cacna1i	UTSW	15	80371529	missense	probably damaging	0.99
R1794:Cacna1i	UTSW	15	80389122	missense	probably damaging	1.00
R1824:Cacna1i	UTSW	15	80376789	missense	possibly damaging	0.64
R1863:Cacna1i	UTSW	15	80358931	missense	probably damaging	1.00
R1885:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1886:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1899:Cacna1i	UTSW	15	80391642	missense	possibly damaging	0.91
R1907:Cacna1i	UTSW	15	80375264	missense	probably damaging	1.00
R1943:Cacna1i	UTSW	15	80395044	missense	probably benign
R2162:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R2888:Cacna1i	UTSW	15	80374767	missense	probably damaging	1.00
R3701:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3702:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3832:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R4852:Cacna1i	UTSW	15	80388479	missense	probably damaging	0.99
R4857:Cacna1i	UTSW	15	80369662	missense	probably damaging	1.00
R4950:Cacna1i	UTSW	15	80368671	missense	probably damaging	1.00
R4980:Cacna1i	UTSW	15	80348449	missense	probably damaging	0.97
R5217:Cacna1i	UTSW	15	80390840	missense	possibly damaging	0.94
R5437:Cacna1i	UTSW	15	80371529	missense	probably damaging	1.00
R5519:Cacna1i	UTSW	15	80371499	missense	probably damaging	1.00
R5642:Cacna1i	UTSW	15	80395078	missense	possibly damaging	0.47
R6217:Cacna1i	UTSW	15	80389132	missense	probably damaging	1.00
R6225:Cacna1i	UTSW	15	80321226	missense	probably damaging	1.00
R6251:Cacna1i	UTSW	15	80336682	missense	probably damaging	1.00
R6463:Cacna1i	UTSW	15	80355758	missense	probably damaging	0.97
R6490:Cacna1i	UTSW	15	80378247	missense	probably damaging	1.00
R6613:Cacna1i	UTSW	15	80321259	missense	probably damaging	1.00
R6884:Cacna1i	UTSW	15	80374809	missense	probably damaging	1.00
R6904:Cacna1i	UTSW	15	80374801	missense	probably damaging	1.00
R7017:Cacna1i	UTSW	15	80380470	missense	probably damaging	1.00
R7155:Cacna1i	UTSW	15	80395238	missense	probably benign	0.04
R7274:Cacna1i	UTSW	15	80376822	missense	possibly damaging	0.95
R7323:Cacna1i	UTSW	15	80391653	missense	possibly damaging	0.86
R7335:Cacna1i	UTSW	15	80375575	missense	probably damaging	1.00
R7571:Cacna1i	UTSW	15	80375336	missense	probably damaging	1.00
R7768:Cacna1i	UTSW	15	80381188	missense	probably damaging	1.00
R7820:Cacna1i	UTSW	15	80372372	missense	probably benign	0.00
R7987:Cacna1i	UTSW	15	80320352	splice site	probably null
R8150:Cacna1i	UTSW	15	80375339	missense	probably damaging	1.00
R8270:Cacna1i	UTSW	15	80373634	missense	probably damaging	0.99
R8382:Cacna1i	UTSW	15	80376816	missense	probably damaging	0.99
R8501:Cacna1i	UTSW	15	80382046	critical splice donor site	probably null
R8518:Cacna1i	UTSW	15	80358894	nonsense	probably null
R8552:Cacna1i	UTSW	15	80320397	missense	possibly damaging	0.69
R8679:Cacna1i	UTSW	15	80375810	intron	probably benign
R8696:Cacna1i	UTSW	15	80381974	missense	probably damaging	0.98
R8887:Cacna1i	UTSW	15	80374693	missense	possibly damaging	0.91
R9274:Cacna1i	UTSW	15	80370153	missense	probably damaging	1.00
R9379:Cacna1i	UTSW	15	80375294	missense	probably damaging	1.00
R9508:Cacna1i	UTSW	15	80395171	missense	probably benign	0.06
R9518:Cacna1i	UTSW	15	80387777	missense	probably damaging	1.00
R9674:Cacna1i	UTSW	15	80380428	missense	probably damaging	1.00
R9747:Cacna1i	UTSW	15	80362117	missense	probably benign	0.11
R9769:Cacna1i	UTSW	15	80369592	missense	probably damaging	1.00
X0022:Cacna1i	UTSW	15	80361962	missense	probably damaging	0.99
X0024:Cacna1i	UTSW	15	80362139	missense	probably benign	0.03
X0058:Cacna1i	UTSW	15	80379102	missense	probably damaging	1.00
Z1177:Cacna1i	UTSW	15	80381179	missense	possibly damaging	0.64
Z1177:Cacna1i	UTSW	15	80389383	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TTCAGCTTCAAGAGAGGGCG -3'
(R):5'- CTTCCTAGACAAACCACTTTGC -3'

Sequencing Primer
(F):5'- ATCCTGTGGTGAGGAGCTCAG -3'
(R):5'- TAGACAAACCACTTTGCGCAGTG -3'

Posted On

2020-10-14