Incidental Mutation 'R8188:Fcamr'
ID652104
Institutional Source Beutler Lab
Gene Symbol Fcamr
Ensembl Gene ENSMUSG00000026415
Gene NameFc receptor, IgA, IgM, high affinity
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8188 (G1)
Quality Score140.008
Status Validated
Chromosome1
Chromosomal Location130800902-130814740 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 130802928 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027670] [ENSMUST00000112477]
Predicted Effect probably benign
Transcript: ENSMUST00000027670
SMART Domains Protein: ENSMUSP00000027670
Gene: ENSMUSG00000026415

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 87 191 1.19e-5 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 241 253 N/A INTRINSIC
transmembrane domain 456 475 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112477
SMART Domains Protein: ENSMUSP00000108096
Gene: ENSMUSG00000026415

DomainStartEndE-ValueType
low complexity region 80 87 N/A INTRINSIC
IG 143 247 1.19e-5 SMART
low complexity region 264 276 N/A INTRINSIC
low complexity region 297 309 N/A INTRINSIC
transmembrane domain 512 531 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Homozygous null mice have enhanced germinal center formation, affinity maturation and memory induction of IgG3 producing B cells after immunization with T cell-independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610001J05Rik C T 6: 13,870,542 G57E probably damaging Het
Aco1 C G 4: 40,180,284 A395G probably benign Het
Adgrf5 G A 17: 43,430,612 C380Y probably damaging Het
Astn2 T C 4: 66,059,181 T422A unknown Het
Baz1b G T 5: 135,205,062 V148F probably benign Het
Bicd1 A C 6: 149,550,356 S823R probably damaging Het
Blvra A C 2: 127,095,127 S167R probably damaging Het
Camsap2 G T 1: 136,297,394 probably null Het
Card14 T C 11: 119,337,797 S650P probably damaging Het
Cdh2 A G 18: 16,648,536 I166T probably damaging Het
Cdnf T C 2: 3,513,191 V22A probably benign Het
Chd2 T A 7: 73,429,756 K1799* probably null Het
Col20a1 G A 2: 181,016,333 probably null Het
Cyp4a31 T C 4: 115,569,746 I182T probably benign Het
Dap3 A T 3: 88,936,236 F25L probably benign Het
Dcc T A 18: 71,810,857 Y241F probably benign Het
Ddx46 A G 13: 55,666,216 I662V possibly damaging Het
Dzip3 T C 16: 48,952,136 D390G probably damaging Het
Eif1 A G 11: 100,320,798 D55G probably benign Het
Exosc5 T A 7: 25,659,365 S44T probably damaging Het
Fat2 A G 11: 55,273,171 V3086A probably damaging Het
Gcg T C 2: 62,478,660 D50G probably damaging Het
Gm15448 T C 7: 3,823,127 H289R unknown Het
Gm4788 T A 1: 139,698,130 I869F probably damaging Het
Gm6588 A G 5: 112,450,127 D180G possibly damaging Het
Gm7298 A G 6: 121,786,578 probably null Het
Hfe A G 13: 23,708,192 V63A probably damaging Het
Hoxd11 T A 2: 74,683,954 I276N probably damaging Het
Htt T C 5: 34,761,943 S13P probably benign Het
Il12a T A 3: 68,691,539 C18S unknown Het
Itk G T 11: 46,331,949 Y564* probably null Het
Lrrc46 A T 11: 97,040,879 L39Q probably damaging Het
Myom3 T A 4: 135,779,920 L537Q probably damaging Het
Nrap A C 19: 56,336,578 Y1234* probably null Het
Olfr635 T C 7: 103,979,536 S121P probably damaging Het
Olfr877 A T 9: 37,855,111 M98L probably benign Het
Parn T C 16: 13,541,156 D574G probably benign Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pclo T A 5: 14,675,179 S1350R unknown Het
Plaa T C 4: 94,586,349 Q272R probably damaging Het
Rfx6 T A 10: 51,718,196 I174N probably benign Het
Ripk2 T A 4: 16,139,218 K226N probably damaging Het
Scgb1b2 T C 7: 31,291,521 D54G possibly damaging Het
Slc45a4 T C 15: 73,584,534 Y599C probably benign Het
Slc7a13 T C 4: 19,819,082 V94A probably benign Het
Slc7a8 A G 14: 54,735,122 F281L probably benign Het
Slco4c1 T A 1: 96,844,536 T243S probably damaging Het
Stat5b A G 11: 100,801,436 I174T probably damaging Het
Styk1 C A 6: 131,304,885 V257L probably benign Het
Tmem268 T C 4: 63,579,972 F210L probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Uhrf1bp1l C T 10: 89,812,066 T1330M possibly damaging Het
Vps50 T A 6: 3,562,297 L464* probably null Het
Zfhx2 A T 14: 55,064,441 S2029T probably benign Het
Zfp235 T A 7: 24,141,871 F572I probably damaging Het
Zfp280d T C 9: 72,360,333 I766T probably benign Het
Zfr T G 15: 12,171,818 C933W probably damaging Het
Other mutations in Fcamr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Fcamr APN 1 130813214 missense probably benign 0.01
IGL02880:Fcamr APN 1 130813334 missense probably benign 0.00
IGL03199:Fcamr APN 1 130812918 missense probably damaging 1.00
IGL03392:Fcamr APN 1 130800948 utr 5 prime probably benign
IGL03398:Fcamr APN 1 130803248 missense probably damaging 0.97
R1101:Fcamr UTSW 1 130814486 splice site probably null
R1312:Fcamr UTSW 1 130811487 missense probably damaging 1.00
R1351:Fcamr UTSW 1 130813020 missense possibly damaging 0.83
R1387:Fcamr UTSW 1 130804642 missense possibly damaging 0.85
R1475:Fcamr UTSW 1 130814484 splice site probably null
R1728:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1728:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1728:Fcamr UTSW 1 130811580 missense probably benign
R1728:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1728:Fcamr UTSW 1 130812692 missense probably benign
R1728:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1728:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1728:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1728:Fcamr UTSW 1 130814597 missense probably benign
R1729:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1729:Fcamr UTSW 1 130811580 missense probably benign
R1729:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1729:Fcamr UTSW 1 130812692 missense probably benign
R1729:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1729:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1729:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1729:Fcamr UTSW 1 130814597 missense probably benign
R1730:Fcamr UTSW 1 130811580 missense probably benign
R1730:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1730:Fcamr UTSW 1 130812692 missense probably benign
R1730:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1730:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1730:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1730:Fcamr UTSW 1 130814597 missense probably benign
R1739:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1739:Fcamr UTSW 1 130811580 missense probably benign
R1739:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1739:Fcamr UTSW 1 130812692 missense probably benign
R1739:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1739:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1739:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1739:Fcamr UTSW 1 130814597 missense probably benign
R1762:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1762:Fcamr UTSW 1 130811580 missense probably benign
R1762:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1762:Fcamr UTSW 1 130812692 missense probably benign
R1762:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1762:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1762:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1762:Fcamr UTSW 1 130814597 missense probably benign
R1783:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1783:Fcamr UTSW 1 130811580 missense probably benign
R1783:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1783:Fcamr UTSW 1 130812692 missense probably benign
R1783:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1783:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1783:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1783:Fcamr UTSW 1 130814597 missense probably benign
R1784:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1784:Fcamr UTSW 1 130811580 missense probably benign
R1784:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1784:Fcamr UTSW 1 130812692 missense probably benign
R1784:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1784:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1784:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1784:Fcamr UTSW 1 130814597 missense probably benign
R1785:Fcamr UTSW 1 130804569 missense probably benign 0.06
R1785:Fcamr UTSW 1 130804627 missense probably benign 0.00
R1785:Fcamr UTSW 1 130811580 missense probably benign
R1785:Fcamr UTSW 1 130812629 missense probably benign 0.38
R1785:Fcamr UTSW 1 130812692 missense probably benign
R1785:Fcamr UTSW 1 130812738 missense probably benign 0.00
R1785:Fcamr UTSW 1 130812809 missense probably benign 0.02
R1785:Fcamr UTSW 1 130812816 missense probably benign 0.41
R1785:Fcamr UTSW 1 130814597 missense probably benign
R1793:Fcamr UTSW 1 130811547 missense probably benign 0.03
R2085:Fcamr UTSW 1 130811598 missense probably damaging 1.00
R3937:Fcamr UTSW 1 130804576 missense probably damaging 0.97
R4529:Fcamr UTSW 1 130804576 missense probably damaging 0.99
R4624:Fcamr UTSW 1 130803262 missense probably damaging 0.99
R4822:Fcamr UTSW 1 130812686 missense possibly damaging 0.82
R5055:Fcamr UTSW 1 130811437 missense probably damaging 1.00
R5514:Fcamr UTSW 1 130814056 missense probably damaging 1.00
R5807:Fcamr UTSW 1 130811526 missense probably damaging 1.00
R6077:Fcamr UTSW 1 130812926 missense probably damaging 1.00
R6200:Fcamr UTSW 1 130803190 missense probably benign 0.16
R6653:Fcamr UTSW 1 130813202 missense possibly damaging 0.89
R7081:Fcamr UTSW 1 130813212 missense probably damaging 1.00
R7362:Fcamr UTSW 1 130814023 missense possibly damaging 0.52
R7828:Fcamr UTSW 1 130811706 missense probably damaging 1.00
R7861:Fcamr UTSW 1 130814638 missense probably benign
X0012:Fcamr UTSW 1 130812734 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GAAAGAATTCCTCTCTGCAAGG -3'
(R):5'- CTCTGGCTGTGCATTCTCAG -3'

Sequencing Primer
(F):5'- CTCTCTGCAAGGGGAAAGG -3'
(R):5'- GTGCATTCTCAGTTTGCTCCAGTAG -3'
Posted On2020-10-15