Incidental Mutation 'R8188:Camsap2'
ID652105
Institutional Source Beutler Lab
Gene Symbol Camsap2
Ensembl Gene ENSMUSG00000041570
Gene Namecalmodulin regulated spectrin-associated protein family, member 2
Synonyms1600013L13Rik, Camsap1l1, 4930541M15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.686) question?
Stock #R8188 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location136268123-136346104 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 136297394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048309] [ENSMUST00000192001] [ENSMUST00000192314]
Predicted Effect probably benign
Transcript: ENSMUST00000048309
SMART Domains Protein: ENSMUSP00000041920
Gene: ENSMUSG00000041570

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 239 322 3.6e-37 PFAM
low complexity region 379 388 N/A INTRINSIC
low complexity region 397 410 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
low complexity region 671 690 N/A INTRINSIC
low complexity region 706 711 N/A INTRINSIC
Pfam:CAMSAP_CC1 738 795 7.3e-28 PFAM
coiled coil region 878 916 N/A INTRINSIC
low complexity region 922 929 N/A INTRINSIC
low complexity region 943 956 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
coiled coil region 1155 1227 N/A INTRINSIC
low complexity region 1242 1256 N/A INTRINSIC
CAMSAP_CKK 1337 1466 1.59e-86 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192001
SMART Domains Protein: ENSMUSP00000142166
Gene: ENSMUSG00000041570

DomainStartEndE-ValueType
Pfam:CH 178 324 1.1e-37 PFAM
Pfam:CAMSAP_CH 222 305 2.7e-36 PFAM
low complexity region 362 371 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
low complexity region 654 673 N/A INTRINSIC
low complexity region 689 694 N/A INTRINSIC
coiled coil region 729 767 N/A INTRINSIC
coiled coil region 861 899 N/A INTRINSIC
low complexity region 905 912 N/A INTRINSIC
low complexity region 926 939 N/A INTRINSIC
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
coiled coil region 1138 1210 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
CAMSAP_CKK 1320 1449 1.59e-86 SMART
Predicted Effect probably null
Transcript: ENSMUST00000192314
SMART Domains Protein: ENSMUSP00000142299
Gene: ENSMUSG00000041570

DomainStartEndE-ValueType
Pfam:CH 178 335 1.2e-35 PFAM
Pfam:CAMSAP_CH 233 316 3.2e-34 PFAM
low complexity region 373 382 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 477 485 N/A INTRINSIC
low complexity region 665 684 N/A INTRINSIC
low complexity region 700 705 N/A INTRINSIC
coiled coil region 740 778 N/A INTRINSIC
coiled coil region 872 910 N/A INTRINSIC
low complexity region 916 923 N/A INTRINSIC
low complexity region 937 950 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1087 1101 N/A INTRINSIC
coiled coil region 1149 1221 N/A INTRINSIC
low complexity region 1236 1250 N/A INTRINSIC
CAMSAP_CKK 1331 1460 1.2e-90 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610001J05Rik C T 6: 13,870,542 G57E probably damaging Het
Aco1 C G 4: 40,180,284 A395G probably benign Het
Adgrf5 G A 17: 43,430,612 C380Y probably damaging Het
Astn2 T C 4: 66,059,181 T422A unknown Het
Baz1b G T 5: 135,205,062 V148F probably benign Het
Bicd1 A C 6: 149,550,356 S823R probably damaging Het
Blvra A C 2: 127,095,127 S167R probably damaging Het
Card14 T C 11: 119,337,797 S650P probably damaging Het
Cdh2 A G 18: 16,648,536 I166T probably damaging Het
Cdnf T C 2: 3,513,191 V22A probably benign Het
Chd2 T A 7: 73,429,756 K1799* probably null Het
Col20a1 G A 2: 181,016,333 probably null Het
Cyp4a31 T C 4: 115,569,746 I182T probably benign Het
Dap3 A T 3: 88,936,236 F25L probably benign Het
Dcc T A 18: 71,810,857 Y241F probably benign Het
Ddx46 A G 13: 55,666,216 I662V possibly damaging Het
Dzip3 T C 16: 48,952,136 D390G probably damaging Het
Eif1 A G 11: 100,320,798 D55G probably benign Het
Exosc5 T A 7: 25,659,365 S44T probably damaging Het
Fat2 A G 11: 55,273,171 V3086A probably damaging Het
Fcamr T A 1: 130,802,928 probably null Het
Gcg T C 2: 62,478,660 D50G probably damaging Het
Gm15448 T C 7: 3,823,127 H289R unknown Het
Gm4788 T A 1: 139,698,130 I869F probably damaging Het
Gm6588 A G 5: 112,450,127 D180G possibly damaging Het
Gm7298 A G 6: 121,786,578 probably null Het
Hfe A G 13: 23,708,192 V63A probably damaging Het
Hoxd11 T A 2: 74,683,954 I276N probably damaging Het
Htt T C 5: 34,761,943 S13P probably benign Het
Il12a T A 3: 68,691,539 C18S unknown Het
Itk G T 11: 46,331,949 Y564* probably null Het
Lrrc46 A T 11: 97,040,879 L39Q probably damaging Het
Myom3 T A 4: 135,779,920 L537Q probably damaging Het
Nrap A C 19: 56,336,578 Y1234* probably null Het
Olfr635 T C 7: 103,979,536 S121P probably damaging Het
Olfr877 A T 9: 37,855,111 M98L probably benign Het
Parn T C 16: 13,541,156 D574G probably benign Het
Pbrm1 A G 14: 31,067,816 I807V probably damaging Het
Pclo T A 5: 14,675,179 S1350R unknown Het
Plaa T C 4: 94,586,349 Q272R probably damaging Het
Rfx6 T A 10: 51,718,196 I174N probably benign Het
Ripk2 T A 4: 16,139,218 K226N probably damaging Het
Scgb1b2 T C 7: 31,291,521 D54G possibly damaging Het
Slc45a4 T C 15: 73,584,534 Y599C probably benign Het
Slc7a13 T C 4: 19,819,082 V94A probably benign Het
Slc7a8 A G 14: 54,735,122 F281L probably benign Het
Slco4c1 T A 1: 96,844,536 T243S probably damaging Het
Stat5b A G 11: 100,801,436 I174T probably damaging Het
Styk1 C A 6: 131,304,885 V257L probably benign Het
Tmem268 T C 4: 63,579,972 F210L probably damaging Het
Ugt2b35 T A 5: 87,001,443 S184R probably damaging Het
Uhrf1bp1l C T 10: 89,812,066 T1330M possibly damaging Het
Vps50 T A 6: 3,562,297 L464* probably null Het
Zfhx2 A T 14: 55,064,441 S2029T probably benign Het
Zfp235 T A 7: 24,141,871 F572I probably damaging Het
Zfp280d T C 9: 72,360,333 I766T probably benign Het
Zfr T G 15: 12,171,818 C933W probably damaging Het
Other mutations in Camsap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Camsap2 APN 1 136297790 missense probably benign 0.23
IGL02727:Camsap2 APN 1 136304312 missense probably benign
IGL02803:Camsap2 APN 1 136281123 missense probably damaging 1.00
IGL03037:Camsap2 APN 1 136274857 missense probably damaging 1.00
IGL03124:Camsap2 APN 1 136274799 critical splice donor site probably null
IGL03189:Camsap2 APN 1 136281662 missense probably damaging 1.00
IGL03297:Camsap2 APN 1 136297801 missense probably benign
IGL03347:Camsap2 APN 1 136280986 missense possibly damaging 0.52
ANU23:Camsap2 UTSW 1 136297790 missense probably benign 0.23
PIT4366001:Camsap2 UTSW 1 136280317 missense
R0001:Camsap2 UTSW 1 136282888 unclassified probably benign
R0037:Camsap2 UTSW 1 136281892 missense probably damaging 1.00
R0140:Camsap2 UTSW 1 136280382 missense probably benign
R0194:Camsap2 UTSW 1 136292948 nonsense probably null
R0206:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0208:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0517:Camsap2 UTSW 1 136293388 missense possibly damaging 0.95
R0648:Camsap2 UTSW 1 136304319 missense probably damaging 0.96
R0735:Camsap2 UTSW 1 136292888 missense probably damaging 1.00
R0790:Camsap2 UTSW 1 136273737 splice site probably benign
R0880:Camsap2 UTSW 1 136280970 missense probably benign 0.08
R1559:Camsap2 UTSW 1 136282094 missense probably benign 0.02
R1728:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1729:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1730:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1739:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1762:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1783:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1784:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1785:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1823:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1824:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1997:Camsap2 UTSW 1 136271545 missense probably damaging 1.00
R2010:Camsap2 UTSW 1 136274868 missense probably damaging 1.00
R2237:Camsap2 UTSW 1 136345331 missense probably damaging 1.00
R2923:Camsap2 UTSW 1 136280809 missense possibly damaging 0.95
R4275:Camsap2 UTSW 1 136270876 missense probably benign 0.01
R4371:Camsap2 UTSW 1 136287963 missense probably damaging 1.00
R4976:Camsap2 UTSW 1 136304386 missense probably damaging 1.00
R5227:Camsap2 UTSW 1 136274891 intron probably benign
R5513:Camsap2 UTSW 1 136280863 missense probably benign 0.23
R5755:Camsap2 UTSW 1 136282327 missense probably damaging 1.00
R5834:Camsap2 UTSW 1 136280388 missense probably benign
R5966:Camsap2 UTSW 1 136276592 missense probably damaging 1.00
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6111:Camsap2 UTSW 1 136281298 missense probably benign
R6147:Camsap2 UTSW 1 136345400 missense probably damaging 1.00
R6284:Camsap2 UTSW 1 136304437 missense possibly damaging 0.63
R6293:Camsap2 UTSW 1 136287920 missense probably damaging 1.00
R6306:Camsap2 UTSW 1 136281199 missense probably benign
R6403:Camsap2 UTSW 1 136280800 nonsense probably null
R6410:Camsap2 UTSW 1 136345444 start gained probably benign
R6943:Camsap2 UTSW 1 136304449 missense probably damaging 1.00
R7268:Camsap2 UTSW 1 136273745 splice site probably null
R7448:Camsap2 UTSW 1 136270906 missense
R7472:Camsap2 UTSW 1 136281393 missense probably damaging 0.96
R7478:Camsap2 UTSW 1 136270940 missense
R7515:Camsap2 UTSW 1 136345370 missense probably damaging 0.99
R7691:Camsap2 UTSW 1 136293004 missense probably damaging 0.99
R7800:Camsap2 UTSW 1 136281901 missense probably damaging 0.99
R8040:Camsap2 UTSW 1 136281247 missense
R8238:Camsap2 UTSW 1 136294026 missense probably benign 0.03
R8258:Camsap2 UTSW 1 136280339 missense probably benign 0.00
R8259:Camsap2 UTSW 1 136280339 missense probably benign 0.00
X0018:Camsap2 UTSW 1 136276575 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGATCCCTCTACTTAATGACAAAC -3'
(R):5'- CTGTAGGATACCGTGAGATAGCAG -3'

Sequencing Primer
(F):5'- GCAGCAAGCTATGGATAATACC -3'
(R):5'- ACCGTGAGATAGCAGAATTATTAAC -3'
Posted On2020-10-15