Incidental Mutation 'R8178:Cdhr3'
ID652110
Institutional Source Beutler Lab
Gene Symbol Cdhr3
Ensembl Gene ENSMUSG00000035860
Gene Namecadherin-related family member 3
Synonyms1110049B09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location33033796-33092875 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 33048932 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095774]
Predicted Effect probably null
Transcript: ENSMUST00000095774
SMART Domains Protein: ENSMUSP00000093449
Gene: ENSMUSG00000035860

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 36 131 5.54e-2 SMART
CA 156 234 3.73e-10 SMART
CA 258 343 5.47e-17 SMART
CA 369 459 9.87e-1 SMART
CA 483 564 1.17e-16 SMART
CA 590 683 1.1e0 SMART
transmembrane domain 708 730 N/A INTRINSIC
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Fbxl17 A C 17: 63,487,972 probably null Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Cdhr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Cdhr3 APN 12 33052209 missense probably benign 0.00
IGL01508:Cdhr3 APN 12 33053428 missense possibly damaging 0.84
IGL02396:Cdhr3 APN 12 33045196 missense possibly damaging 0.64
IGL02414:Cdhr3 APN 12 33042504 missense possibly damaging 0.76
IGL02450:Cdhr3 APN 12 33082225 missense probably benign
IGL02453:Cdhr3 APN 12 33042503 missense probably damaging 0.97
IGL02567:Cdhr3 APN 12 33038901 missense probably benign 0.02
IGL03342:Cdhr3 APN 12 33051055 missense probably benign 0.14
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0022:Cdhr3 UTSW 12 33082264 missense probably damaging 1.00
R0133:Cdhr3 UTSW 12 33092752 missense possibly damaging 0.94
R0140:Cdhr3 UTSW 12 33080413 missense probably benign 0.00
R0157:Cdhr3 UTSW 12 33061650 missense possibly damaging 0.52
R0762:Cdhr3 UTSW 12 33060301 missense probably benign 0.01
R1421:Cdhr3 UTSW 12 33060292 missense probably damaging 1.00
R1553:Cdhr3 UTSW 12 33042371 missense probably benign 0.10
R1691:Cdhr3 UTSW 12 33082247 missense probably damaging 0.99
R1822:Cdhr3 UTSW 12 33045205 missense probably null 1.00
R1855:Cdhr3 UTSW 12 33060352 missense probably damaging 1.00
R1897:Cdhr3 UTSW 12 33045193 missense possibly damaging 0.81
R2496:Cdhr3 UTSW 12 33049069 missense probably benign 0.01
R2507:Cdhr3 UTSW 12 33038915 missense probably benign
R3155:Cdhr3 UTSW 12 33049153 missense possibly damaging 0.83
R3906:Cdhr3 UTSW 12 33053428 missense probably damaging 0.97
R4005:Cdhr3 UTSW 12 33080356 missense probably damaging 0.98
R4277:Cdhr3 UTSW 12 33060233 missense probably null 0.16
R4573:Cdhr3 UTSW 12 33068153 splice site probably null
R4752:Cdhr3 UTSW 12 33086103 missense probably damaging 0.99
R5364:Cdhr3 UTSW 12 33051008 missense possibly damaging 0.67
R5562:Cdhr3 UTSW 12 33051055 missense probably benign 0.01
R5564:Cdhr3 UTSW 12 33048986 nonsense probably null
R5768:Cdhr3 UTSW 12 33046686 missense possibly damaging 0.73
R6255:Cdhr3 UTSW 12 33053475 missense probably damaging 1.00
R6821:Cdhr3 UTSW 12 33035045 missense probably damaging 1.00
R6983:Cdhr3 UTSW 12 33042380 missense probably benign 0.32
R7155:Cdhr3 UTSW 12 33061773 missense probably damaging 1.00
R7496:Cdhr3 UTSW 12 33060265 missense probably damaging 1.00
R7736:Cdhr3 UTSW 12 33053520 missense probably benign 0.33
R7788:Cdhr3 UTSW 12 33060320 missense probably damaging 1.00
RF023:Cdhr3 UTSW 12 33060349 missense probably damaging 1.00
X0024:Cdhr3 UTSW 12 33067236 missense possibly damaging 0.90
X0028:Cdhr3 UTSW 12 33042456 missense probably benign
Z1176:Cdhr3 UTSW 12 33060322 missense probably damaging 1.00
Z1176:Cdhr3 UTSW 12 33080324 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ACCAAGTGGCTTTGTGGCTTC -3'
(R):5'- CAGTGGTGTATTCCGTATCCAG -3'

Sequencing Primer
(F):5'- CAGTAGATATGCCAGTGTCTTGCC -3'
(R):5'- TATTCCGTATCCAGAGGAGGGTCC -3'
Posted On2020-10-15