Incidental Mutation 'R8178:Fbxl17'
ID652112
Institutional Source Beutler Lab
Gene Symbol Fbxl17
Ensembl Gene ENSMUSG00000023965
Gene NameF-box and leucine-rich repeat protein 17
Synonyms6330576B01Rik, Fbxo13, Fbx13, C130023C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R8178 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location63057452-63500017 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to C at 63487972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024761] [ENSMUST00000024761] [ENSMUST00000112840] [ENSMUST00000112840]
Predicted Effect probably null
Transcript: ENSMUST00000024761
SMART Domains Protein: ENSMUSP00000024761
Gene: ENSMUSG00000023965

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
low complexity region 103 138 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
low complexity region 214 245 N/A INTRINSIC
low complexity region 246 270 N/A INTRINSIC
FBOX 324 365 3.1e-8 SMART
LRR 359 384 4.6e-1 SMART
LRR 385 410 2e-1 SMART
LRR 411 436 8.5e-2 SMART
LRR 437 462 6.9e-4 SMART
LRR 463 488 1.3e-5 SMART
LRR 489 514 5.2e-2 SMART
LRR 515 539 2.9e-3 SMART
LRR 540 564 2e-1 SMART
low complexity region 567 580 N/A INTRINSIC
LRR 591 615 8.4e-4 SMART
LRR 616 641 2.2e-1 SMART
LRR 642 667 6.3e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000024761
SMART Domains Protein: ENSMUSP00000024761
Gene: ENSMUSG00000023965

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
low complexity region 103 138 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
low complexity region 214 245 N/A INTRINSIC
low complexity region 246 270 N/A INTRINSIC
FBOX 324 365 3.1e-8 SMART
LRR 359 384 4.6e-1 SMART
LRR 385 410 2e-1 SMART
LRR 411 436 8.5e-2 SMART
LRR 437 462 6.9e-4 SMART
LRR 463 488 1.3e-5 SMART
LRR 489 514 5.2e-2 SMART
LRR 515 539 2.9e-3 SMART
LRR 540 564 2e-1 SMART
low complexity region 567 580 N/A INTRINSIC
LRR 591 615 8.4e-4 SMART
LRR 616 641 2.2e-1 SMART
LRR 642 667 6.3e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112840
SMART Domains Protein: ENSMUSP00000108459
Gene: ENSMUSG00000023965

DomainStartEndE-ValueType
LRR 8 33 1.2e1 SMART
LRR 34 58 6.57e-1 SMART
LRR 59 83 4.67e1 SMART
low complexity region 86 99 N/A INTRINSIC
LRR 110 134 1.89e-1 SMART
LRR 135 160 5.25e1 SMART
LRR 161 186 1.47e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000112840
SMART Domains Protein: ENSMUSP00000108459
Gene: ENSMUSG00000023965

DomainStartEndE-ValueType
LRR 8 33 1.2e1 SMART
LRR 34 58 6.57e-1 SMART
LRR 59 83 4.67e1 SMART
low complexity region 86 99 N/A INTRINSIC
LRR 110 134 1.89e-1 SMART
LRR 135 160 5.25e1 SMART
LRR 161 186 1.47e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL17, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A G 17: 79,628,270 I276V Het
Acsm5 C A 7: 119,542,395 H538N probably damaging Het
Adamts17 A G 7: 66,849,716 I4V possibly damaging Het
Adgrg3 T C 8: 95,035,047 V146A probably damaging Het
Ankrd52 T A 10: 128,389,301 L877Q probably damaging Het
Aox3 A T 1: 58,150,322 D394V possibly damaging Het
Arhgef4 A G 1: 34,722,902 E413G unknown Het
Arhgef5 T C 6: 43,275,185 S957P probably benign Het
Arsk G T 13: 76,091,742 T114K probably damaging Het
Bpifb2 T C 2: 153,891,956 V406A probably damaging Het
Carkd A C 8: 11,511,987 K275Q probably benign Het
Cbr3 C A 16: 93,683,505 Q61K probably benign Het
Ccdc73 C T 2: 104,991,212 S502L probably benign Het
Cdhr3 A T 12: 33,048,932 probably null Het
Cep170b T A 12: 112,739,285 M1159K possibly damaging Het
Cep295 A T 9: 15,333,540 S1159T Het
Cit C T 5: 115,969,072 R1088W probably damaging Het
Col16a1 A T 4: 130,053,477 H205L unknown Het
Cpt1c T G 7: 44,959,653 H748P probably damaging Het
Dcaf8 A T 1: 172,186,319 D359V probably benign Het
Dcstamp A G 15: 39,755,026 Y277C probably damaging Het
Dnah10 A G 5: 124,755,726 K898R probably benign Het
Dnah6 T A 6: 73,060,225 T3345S probably benign Het
Dpp6 A T 5: 27,598,817 N254Y probably damaging Het
F2 A T 2: 91,630,273 probably null Het
Fam216b G C 14: 78,085,064 H67D possibly damaging Het
Gas2 T A 7: 51,897,278 M59K probably damaging Het
Glud1 G A 14: 34,343,707 G554D probably damaging Het
Gm15448 T C 7: 3,821,261 K631R unknown Het
Gm5483 T G 16: 36,186,402 Y35* probably null Het
Gys2 C T 6: 142,456,412 G234R probably damaging Het
Hmha1 G A 10: 80,027,872 A819T probably damaging Het
Ifngr1 A G 10: 19,609,493 I413M probably benign Het
Inpp5a C T 7: 139,538,237 R236C probably damaging Het
Kcnip3 A G 2: 127,482,014 S32P probably benign Het
Lingo3 T A 10: 80,834,630 T489S possibly damaging Het
Lrpprc A G 17: 84,772,147 L227P probably damaging Het
Morn1 A G 4: 155,128,703 Q356R probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nck1 A T 9: 100,497,737 W154R probably damaging Het
Olfr1109 C T 2: 87,092,876 V174M possibly damaging Het
Olfr51 T A 11: 51,007,610 C213S probably damaging Het
Olfr869 T C 9: 20,137,275 V53A possibly damaging Het
Olfr975 G A 9: 39,950,412 R120C probably benign Het
Pdxk C T 10: 78,453,504 V38M probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pes1 T C 11: 3,977,718 S482P probably benign Het
Pglyrp1 T A 7: 18,884,732 F3I unknown Het
Plce1 T A 19: 38,772,979 F2092I possibly damaging Het
Pms1 A G 1: 53,207,346 S345P probably benign Het
Pom121l12 C A 11: 14,600,011 P239H probably damaging Het
Prdm2 A G 4: 143,132,448 I1424T probably benign Het
Prmt6 A G 3: 110,250,824 Y50H probably damaging Het
Rbm39 T C 2: 156,154,275 I397V probably benign Het
Rnf157 A G 11: 116,347,481 V519A possibly damaging Het
Sec23a T C 12: 59,007,194 E6G possibly damaging Het
Shank1 T C 7: 44,313,324 probably null Het
Slfn3 A G 11: 83,214,679 I378V probably benign Het
Smn1 T A 13: 100,130,795 probably null Het
Snd1 T C 6: 28,874,976 F632S possibly damaging Het
Sun5 T C 2: 153,856,211 probably null Het
Tial1 T C 7: 128,444,890 R209G probably benign Het
Trhde T C 10: 114,408,693 I963V possibly damaging Het
Tssc4 G T 7: 143,070,195 R80L possibly damaging Het
Ttn A T 2: 76,812,508 N13261K probably damaging Het
Ugdh A T 5: 65,423,662 probably null Het
Vmn1r218 A T 13: 23,137,302 E273V probably benign Het
Vmn2r92 T A 17: 18,166,726 F109Y possibly damaging Het
Zcchc7 A G 4: 44,931,398 S196G probably benign Het
Zfp788 T A 7: 41,648,911 C324S probably damaging Het
Zfp976 T C 7: 42,613,535 T294A probably benign Het
Other mutations in Fbxl17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Fbxl17 APN 17 63385052 missense probably damaging 1.00
IGL02201:Fbxl17 APN 17 63499029 missense probably damaging 1.00
IGL02256:Fbxl17 APN 17 63499090 missense probably benign
IGL03408:Fbxl17 APN 17 63080546 nonsense probably null
R0268:Fbxl17 UTSW 17 63385067 splice site probably benign
R0269:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R0313:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0315:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0344:Fbxl17 UTSW 17 63385067 splice site probably benign
R0356:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0358:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0553:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0617:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R0629:Fbxl17 UTSW 17 63471414 missense probably damaging 1.00
R1597:Fbxl17 UTSW 17 63487818 missense probably damaging 1.00
R1666:Fbxl17 UTSW 17 63385065 splice site probably null
R3001:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3002:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3121:Fbxl17 UTSW 17 63471424 missense probably damaging 0.96
R3909:Fbxl17 UTSW 17 63499807 missense possibly damaging 0.93
R4789:Fbxl17 UTSW 17 63487915 missense probably benign 0.40
R6606:Fbxl17 UTSW 17 63487788 missense probably damaging 0.97
R7153:Fbxl17 UTSW 17 63060351 missense probably benign 0.09
R7722:Fbxl17 UTSW 17 63356828 missense probably damaging 0.99
R7794:Fbxl17 UTSW 17 63356811 missense probably damaging 0.97
R7841:Fbxl17 UTSW 17 63487825 missense probably damaging 1.00
R8076:Fbxl17 UTSW 17 63060365 missense probably damaging 0.99
R8338:Fbxl17 UTSW 17 63356758 missense possibly damaging 0.93
X0019:Fbxl17 UTSW 17 63060383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGACTTTCTGCAGTAAAGGG -3'
(R):5'- ATGACTCTGACACTCGGAAGG -3'

Sequencing Primer
(F):5'- ACGCGACCGCAATGATTG -3'
(R):5'- GAAGGTTCCAAGGGTTTTAGAAAG -3'
Posted On2020-10-15