Incidental Mutation 'R8229:Ermard'
ID652116
Institutional Source Beutler Lab
Gene Symbol Ermard
Ensembl Gene ENSMUSG00000036552
Gene NameER membrane associated RNA degradation
Synonyms2410011O22Rik, 2210404J11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R8229 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location15041208-15090044 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 15059334 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040594] [ENSMUST00000097393]
Predicted Effect probably benign
Transcript: ENSMUST00000040594
SMART Domains Protein: ENSMUSP00000043677
Gene: ENSMUSG00000036552

DomainStartEndE-ValueType
transmembrane domain 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097393
SMART Domains Protein: ENSMUSP00000095005
Gene: ENSMUSG00000036552

DomainStartEndE-ValueType
Pfam:DUF4209 133 214 3.1e-27 PFAM
low complexity region 390 399 N/A INTRINSIC
SCOP:g1pnb.1 429 478 4e-3 SMART
low complexity region 583 599 N/A INTRINSIC
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains 2 transmembrane domains near the C-terminus and is localized in the endoplasmic reticulum. Knockout of this gene in developing rat brain showed that it may be involved in neuronal migration. Mutations in this gene are associated with periventricular nodular heterotopia-6 (PVNH6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 A T 8: 24,711,738 M203K probably damaging Het
Arhgap23 G A 11: 97,453,906 V565I probably benign Het
D6Wsu163e G T 6: 126,967,003 R454L probably benign Het
Def6 A G 17: 28,217,755 D131G probably damaging Het
Erc1 T C 6: 119,753,288 T616A probably benign Het
Fsip2 T C 2: 82,978,143 L1602P possibly damaging Het
Gli1 C T 10: 127,332,448 R512Q possibly damaging Het
Gm6034 A G 17: 36,056,376 T38A unknown Het
H2-M10.1 T C 17: 36,324,039 I325V probably benign Het
Inf2 A G 12: 112,611,596 D1107G unknown Het
Iws1 A G 18: 32,084,687 N448S probably benign Het
Klhl24 T C 16: 20,114,571 Y311H possibly damaging Het
Lama3 C T 18: 12,407,551 A304V probably benign Het
Limch1 A G 5: 67,028,795 E646G probably damaging Het
Lrrc8c T A 5: 105,606,536 V59E probably benign Het
Lrrn4 G A 2: 132,869,887 T672I probably damaging Het
Magi3 C A 3: 104,015,701 E1233D possibly damaging Het
Magi3 T C 3: 104,015,702 E1233G probably benign Het
Mgat5b A T 11: 116,947,387 K284M probably benign Het
Nedd4 G T 9: 72,731,388 K485N probably benign Het
Olfr1141 A T 2: 87,753,064 C310S probably benign Het
Olfr1219 T A 2: 89,075,038 N18Y possibly damaging Het
Olfr1453 A G 19: 13,028,197 I44T possibly damaging Het
Olfr480 C T 7: 108,066,587 M70I probably benign Het
Otud4 A G 8: 79,673,975 H1106R unknown Het
Pcdha7 C A 18: 36,974,723 S267* probably null Het
Pcdhb11 A G 18: 37,422,618 I334V probably benign Het
Phf11b A T 14: 59,331,281 L61Q probably damaging Het
Prepl T C 17: 85,081,261 D138G probably benign Het
Sipa1l1 T C 12: 82,437,848 V1592A probably damaging Het
Smc6 T A 12: 11,291,672 S564T probably benign Het
Spty2d1 A G 7: 46,997,774 V469A probably benign Het
Trim11 G A 11: 58,981,341 probably benign Het
Ttll7 T A 3: 146,901,449 I158K probably damaging Het
Ugt3a2 A G 15: 9,367,377 E402G probably damaging Het
Usp33 T C 3: 152,370,292 V383A probably benign Het
Ythdc1 A G 5: 86,809,308 probably benign Het
Ywhab T G 2: 164,014,095 Y130* probably null Het
Zfp609 T C 9: 65,703,500 K727R possibly damaging Het
Zscan30 A C 18: 23,971,680 L37R noncoding transcript Het
Other mutations in Ermard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ermard APN 17 14988066 splice site probably benign
IGL01554:Ermard APN 17 15051593 missense possibly damaging 0.94
IGL01832:Ermard APN 17 15059849 missense probably damaging 0.98
IGL02045:Ermard APN 17 15051564 unclassified probably benign
IGL02332:Ermard APN 17 14990545 critical splice acceptor site probably null
IGL02525:Ermard APN 17 15059339 splice site probably benign
IGL03335:Ermard APN 17 15059406 missense probably damaging 1.00
Angelos UTSW 17 15059770 missense possibly damaging 0.73
Eminence UTSW 17 15053205 splice site probably null
Rechthand UTSW 17 15059334 splice site probably benign
PIT4504001:Ermard UTSW 17 15058822 nonsense probably null
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0722:Ermard UTSW 17 15022128 missense probably benign 0.13
R0785:Ermard UTSW 17 15021977 missense probably damaging 1.00
R2019:Ermard UTSW 17 15053265 missense probably damaging 1.00
R3696:Ermard UTSW 17 15053376 missense probably benign 0.01
R3697:Ermard UTSW 17 15053376 missense probably benign 0.01
R4077:Ermard UTSW 17 15053376 missense probably benign 0.04
R4383:Ermard UTSW 17 15059866 missense possibly damaging 0.87
R5424:Ermard UTSW 17 15059770 missense possibly damaging 0.73
R6313:Ermard UTSW 17 15053205 splice site probably null
R7685:Ermard UTSW 17 15059462 missense probably benign 0.00
R7800:Ermard UTSW 17 15056803 missense probably benign 0.01
R7802:Ermard UTSW 17 15061161 missense probably benign
R7895:Ermard UTSW 17 15063613 missense possibly damaging 0.66
R8203:Ermard UTSW 17 15020286 missense possibly damaging 0.73
R8318:Ermard UTSW 17 15022072 missense possibly damaging 0.86
R8369:Ermard UTSW 17 15053298 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTTGCATTGTGTCTTGCAGC -3'
(R):5'- GGCCAATCCCAAATTGCTG -3'

Sequencing Primer
(F):5'- GTCTTGCAGCTAGCTTATCATTG -3'
(R):5'- AAGTCTGCTACCATAAATTCCTCAG -3'
Posted On2020-10-15