Incidental Mutation 'R8232:Bmp1'
ID 652118
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 067664-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8232 (G1)
Quality Score 76.0075
Status Validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70757329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 50 (Y50F)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022692] [ENSMUST00000022693]
AlphaFold P98063
Predicted Effect probably benign
Transcript: ENSMUST00000022692
SMART Domains Protein: ENSMUSP00000022692
Gene: ENSMUSG00000022097

DomainStartEndE-ValueType
SF_P 1 193 7.3e-150 SMART
BRICHOS 94 193 3.29e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022693
AA Change: Y50F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: Y50F

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Meta Mutation Damage Score 0.0678 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A T 4: 49,450,817 (GRCm39) M98K probably damaging Het
Actn3 A T 19: 4,921,683 (GRCm39) W166R probably damaging Het
Adamts16 C A 13: 70,941,217 (GRCm39) C390F probably damaging Het
Arhgap32 A T 9: 32,168,198 (GRCm39) D727V probably damaging Het
Bcr A G 10: 75,001,883 (GRCm39) Y929C probably damaging Het
Camta2 G A 11: 70,573,841 (GRCm39) R171C unknown Het
Ccnd2 A G 6: 127,127,549 (GRCm39) L63P probably damaging Het
Clip1 G C 5: 123,785,981 (GRCm39) D234E probably benign Het
Dnah9 A T 11: 65,746,149 (GRCm39) I3988N possibly damaging Het
Frmpd2 T G 14: 33,261,724 (GRCm39) I843S probably damaging Het
Gcgr A G 11: 120,427,328 (GRCm39) Y146C probably damaging Het
Gm5930 T G 14: 44,573,181 (GRCm39) K158T probably damaging Het
Gnl1 T A 17: 36,298,487 (GRCm39) C410* probably null Het
Gtf2h1 T A 7: 46,451,103 (GRCm39) I4K probably benign Het
Il12b A G 11: 44,299,401 (GRCm39) S157G possibly damaging Het
Jcad G T 18: 4,674,862 (GRCm39) A875S probably benign Het
Kcnrg T A 14: 61,845,386 (GRCm39) M142K probably benign Het
Krtap4-6 A C 11: 99,556,568 (GRCm39) L53R unknown Het
Myo10 G A 15: 25,804,400 (GRCm39) G1565D possibly damaging Het
Nf1 A G 11: 79,469,157 (GRCm39) S806G probably damaging Het
Nlrp5 G T 7: 23,116,770 (GRCm39) V165L probably benign Het
Nppa T C 4: 148,085,795 (GRCm39) I134T possibly damaging Het
Or4a72 A T 2: 89,405,938 (GRCm39) V44E noncoding transcript Het
Or51ai2 G A 7: 103,586,980 (GRCm39) R131Q possibly damaging Het
Or5b107 A G 19: 13,142,683 (GRCm39) M102V probably benign Het
Or5p68 A T 7: 107,945,495 (GRCm39) M231K probably damaging Het
Or6c202 C A 10: 128,996,097 (GRCm39) C252F probably damaging Het
Scyl2 A T 10: 89,498,309 (GRCm39) F167I probably damaging Het
Smarcal1 T C 1: 72,665,722 (GRCm39) L740S probably damaging Het
Tmem183a T A 1: 134,277,918 (GRCm39) D282V probably damaging Het
Trhde A T 10: 114,636,442 (GRCm39) V255E possibly damaging Het
Vmn1r229 T A 17: 21,035,309 (GRCm39) C185S probably damaging Het
Vmn2r58 A T 7: 41,514,076 (GRCm39) M189K probably damaging Het
Vps50 T G 6: 3,600,139 (GRCm39) V866G probably damaging Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7716:Bmp1 UTSW 14 70,715,362 (GRCm39) nonsense probably null
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCATTGCCAACCAAGCAG -3'
(R):5'- GCGAGCTCATTTCCCTAAAAGG -3'

Sequencing Primer
(F):5'- GCTCCCAGCTTCCCACAC -3'
(R):5'- GAGAGCGCCTCCCCTTC -3'
Posted On 2020-10-16