Incidental Mutation 'R8360:Golm2'
ID 652129
Institutional Source Beutler Lab
Gene Symbol Golm2
Ensembl Gene ENSMUSG00000060227
Gene Name golgi membrane protein 2
Synonyms D130060C09Rik, Casc4
MMRRC Submission 067734-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8360 (G1)
Quality Score 150.008
Status Not validated
Chromosome 2
Chromosomal Location 121697451-121766701 bp(+) (GRCm39)
Type of Mutation start gained
DNA Base Change (assembly) A to T at 121697632 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078752] [ENSMUST00000089912] [ENSMUST00000089915] [ENSMUST00000110586]
AlphaFold Q6P2L7
Predicted Effect probably benign
Transcript: ENSMUST00000078752
SMART Domains Protein: ENSMUSP00000077811
Gene: ENSMUSG00000060227

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 37 195 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089912
SMART Domains Protein: ENSMUSP00000087357
Gene: ENSMUSG00000060227

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 37 195 N/A INTRINSIC
low complexity region 367 385 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089915
SMART Domains Protein: ENSMUSP00000087360
Gene: ENSMUSG00000060227

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 37 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110586
SMART Domains Protein: ENSMUSP00000106216
Gene: ENSMUSG00000060227

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
coiled coil region 37 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The increased expression level of this gene is associated with HER-2/neu proto-oncogene overexpression. Amplification and resulting overexpression of this proto-oncogene are found in approximately 30% of human breast and 20% of human ovarian cancers. Alternatively spliced variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b C T 19: 21,655,888 (GRCm39) Q57* probably null Het
Acad8 C T 9: 26,890,352 (GRCm39) A288T possibly damaging Het
Adamtsl3 G A 7: 82,197,187 (GRCm39) C711Y probably damaging Het
Ahcyl2 C A 6: 29,768,869 (GRCm39) D111E probably benign Het
Asxl3 T C 18: 22,649,174 (GRCm39) F388L probably benign Het
Bcr T A 10: 74,981,271 (GRCm39) S697T probably damaging Het
Catspere2 G A 1: 177,842,724 (GRCm39) V50M possibly damaging Het
Dgka C A 10: 128,563,997 (GRCm39) V451F probably damaging Het
Dnajc2 A T 5: 21,962,705 (GRCm39) C617S unknown Het
Erich3 C A 3: 154,469,991 (GRCm39) T1481K unknown Het
Hdac2 T A 10: 36,874,059 (GRCm39) D396E probably benign Het
Hmgcs2 A T 3: 98,204,724 (GRCm39) D294V possibly damaging Het
Hnf1a A G 5: 115,091,391 (GRCm39) V434A possibly damaging Het
Il4ra T C 7: 125,169,138 (GRCm39) L130P probably damaging Het
Inpp5j T C 11: 3,449,767 (GRCm39) K672E probably damaging Het
Kif16b G A 2: 142,553,777 (GRCm39) A1007V probably benign Het
Kif26b T C 1: 178,743,938 (GRCm39) S1345P probably benign Het
Lrrc28 A T 7: 67,290,909 (GRCm39) D37E probably benign Het
Mlx G T 11: 100,978,140 (GRCm39) probably benign Het
Muc16 T C 9: 18,436,554 (GRCm39) H7878R probably benign Het
Mybpc1 C A 10: 88,409,359 (GRCm39) E32* probably null Het
Nebl C T 2: 17,465,298 (GRCm39) V18M probably benign Het
Nhsl3 C T 4: 129,117,995 (GRCm39) R268Q possibly damaging Het
Nlrp3 T C 11: 59,440,229 (GRCm39) V602A probably benign Het
Npepps G A 11: 97,120,665 (GRCm39) P532S probably benign Het
Or7g12 T A 9: 18,900,139 (GRCm39) M285K probably benign Het
Or8g19 C T 9: 39,055,761 (GRCm39) R122* probably null Het
Or8k53 T C 2: 86,177,668 (GRCm39) I147M possibly damaging Het
Pfdn1 G A 18: 36,584,214 (GRCm39) T40M probably benign Het
Pkd2 G T 5: 104,607,653 (GRCm39) E51* probably null Het
Prss40 T A 1: 34,599,876 (GRCm39) H37L probably benign Het
Rab11fip1 A T 8: 27,642,374 (GRCm39) C808* probably null Het
Rab3gap2 A T 1: 184,999,270 (GRCm39) probably benign Het
Sall3 C T 18: 81,017,232 (GRCm39) R232H probably benign Het
Sbk3 A G 7: 4,970,707 (GRCm39) F221L probably damaging Het
Sema7a T G 9: 57,862,974 (GRCm39) probably benign Het
Serpina3b C A 12: 104,104,962 (GRCm39) N379K probably benign Het
Ssbp4 A G 8: 71,052,039 (GRCm39) L208P probably benign Het
Stxbp5 C T 10: 9,688,003 (GRCm39) probably null Het
Tecrl A G 5: 83,448,764 (GRCm39) Y160H probably damaging Het
Tnc T C 4: 63,885,511 (GRCm39) I1773V probably benign Het
Ush2a A G 1: 188,198,468 (GRCm39) T1511A probably benign Het
Utp15 T C 13: 98,391,499 (GRCm39) N246S probably damaging Het
Vmn1r49 C T 6: 90,049,991 (GRCm39) A4T probably benign Het
Vmn2r57 A T 7: 41,049,640 (GRCm39) I703N probably damaging Het
Wdr93 A G 7: 79,398,974 (GRCm39) D36G probably damaging Het
Zfp334 A G 2: 165,225,278 (GRCm39) I8T probably benign Het
Other mutations in Golm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Golm2 APN 2 121,741,274 (GRCm39) splice site probably benign
IGL01020:Golm2 APN 2 121,756,203 (GRCm39) missense probably benign 0.06
IGL01794:Golm2 APN 2 121,742,407 (GRCm39) missense probably benign 0.36
IGL02429:Golm2 APN 2 121,742,468 (GRCm39) missense probably benign 0.00
R0126:Golm2 UTSW 2 121,736,565 (GRCm39) splice site probably benign
R0709:Golm2 UTSW 2 121,697,906 (GRCm39) missense probably damaging 1.00
R2182:Golm2 UTSW 2 121,697,909 (GRCm39) missense probably damaging 1.00
R4771:Golm2 UTSW 2 121,756,126 (GRCm39) missense probably damaging 1.00
R5533:Golm2 UTSW 2 121,756,178 (GRCm39) intron probably benign
R5817:Golm2 UTSW 2 121,736,525 (GRCm39) missense probably benign 0.30
R6519:Golm2 UTSW 2 121,737,218 (GRCm39) missense probably benign 0.31
R6598:Golm2 UTSW 2 121,763,967 (GRCm39) missense probably damaging 1.00
R6598:Golm2 UTSW 2 121,763,966 (GRCm39) missense probably damaging 1.00
R7799:Golm2 UTSW 2 121,764,022 (GRCm39) missense probably benign 0.01
R8009:Golm2 UTSW 2 121,737,242 (GRCm39) missense probably benign 0.00
R8359:Golm2 UTSW 2 121,697,632 (GRCm39) start gained probably benign
R8995:Golm2 UTSW 2 121,756,199 (GRCm39) missense probably damaging 1.00
R9095:Golm2 UTSW 2 121,756,096 (GRCm39) missense probably damaging 1.00
R9620:Golm2 UTSW 2 121,737,242 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGAAGCCCACTATCTCGCG -3'
(R):5'- TCCGAATTGCGCTTCTCCAAG -3'

Sequencing Primer
(F):5'- CCACTATCTCGCGAGAAGAGG -3'
(R):5'- TCCTCCTGAAGCAGAACGTG -3'
Posted On 2020-10-20