Incidental Mutation 'R0335:Top2a'
ID65213
Institutional Source Beutler Lab
Gene Symbol Top2a
Ensembl Gene ENSMUSG00000020914
Gene Nametopoisomerase (DNA) II alpha
SynonymsTop-2, DNA Topoisomerase II alpha
MMRRC Submission 038544-MU
Accession Numbers

Ncbi RefSeq: NM_011623.2; MGI:98790

Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R0335 (G1)
Quality Score157
Status Validated
Chromosome11
Chromosomal Location98992943-99024189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99022955 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 20 (N20S)
Ref Sequence ENSEMBL: ENSMUSP00000068896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068031]
Predicted Effect probably benign
Transcript: ENSMUST00000068031
AA Change: N20S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000068896
Gene: ENSMUSG00000020914
AA Change: N20S

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Blast:TOP2c 22 60 3e-12 BLAST
HATPase_c 75 224 1.81e-2 SMART
TOP2c 79 669 N/A SMART
TOP4c 692 1166 3.58e-234 SMART
low complexity region 1192 1202 N/A INTRINSIC
low complexity region 1226 1238 N/A INTRINSIC
low complexity region 1261 1273 N/A INTRINSIC
low complexity region 1291 1306 N/A INTRINSIC
low complexity region 1407 1418 N/A INTRINSIC
Pfam:DTHCT 1425 1518 1.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139730
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.6%
  • 20x: 87.5%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, alpha, is localized to chromosome 17 and the beta gene is localized to chromosome 3. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. [provided by RefSeq, Jul 2010]
Allele List at MGI

All alleles(47) : Targeted(1) Gene trapped(46)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830406C13Rik A G 14: 12,301,266 E124G possibly damaging Het
4932438A13Rik T C 3: 36,969,152 V2210A probably damaging Het
Adamts12 G T 15: 11,311,058 D1134Y possibly damaging Het
Add3 A G 19: 53,236,828 T460A probably benign Het
Amer3 A C 1: 34,579,300 probably benign Het
Arhgap22 C T 14: 33,359,108 probably benign Het
Arhgap32 T G 9: 32,259,760 S1279A probably benign Het
Bcas1 G A 2: 170,418,681 T26M probably damaging Het
Begain A T 12: 109,038,934 F256I probably damaging Het
Cabin1 A T 10: 75,657,049 I1804N probably damaging Het
Cad G A 5: 31,073,985 probably benign Het
Carmil1 G A 13: 24,073,983 S762L probably damaging Het
Ccdc93 T A 1: 121,492,977 L529Q probably damaging Het
Cdh12 T A 15: 21,578,549 probably null Het
Clip2 T A 5: 134,535,215 probably benign Het
Cmip T C 8: 117,445,366 I480T probably damaging Het
Cnot1 A T 8: 95,772,000 I203K probably benign Het
Col18a1 G A 10: 77,059,363 P1155S probably damaging Het
Col1a2 T A 6: 4,531,956 probably benign Het
Crybg3 A T 16: 59,544,140 L2373Q probably damaging Het
D130043K22Rik A T 13: 24,887,877 I935F probably damaging Het
Dapl1 T A 2: 59,496,594 D61E possibly damaging Het
Def6 A G 17: 28,228,069 D558G possibly damaging Het
Dnah6 T C 6: 73,069,399 probably benign Het
Dvl2 G A 11: 70,001,035 probably benign Het
Ecd A C 14: 20,320,734 V639G probably benign Het
Epg5 C T 18: 77,986,472 T1350M probably benign Het
Erbb4 C A 1: 68,259,259 M657I probably benign Het
Evi5 T C 5: 107,812,411 R431G probably benign Het
Fbxo11 G A 17: 88,015,613 A115V possibly damaging Het
Fgfr2 T C 7: 130,196,249 T192A probably benign Het
Gas7 C T 11: 67,662,052 A146V possibly damaging Het
Gatad2b T A 3: 90,356,182 S529T probably benign Het
Gm10722 G T 9: 3,001,048 Q41H probably null Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Gm7535 A G 17: 17,911,112 probably benign Het
Gstm1 T A 3: 108,012,696 N193I possibly damaging Het
Heatr5b G A 17: 78,827,946 P252L probably benign Het
Hmgb1 A G 5: 149,050,631 V36A probably benign Het
Hrh1 G T 6: 114,480,232 W158L probably damaging Het
Ighv6-4 T C 12: 114,406,674 M53V probably benign Het
Iqgap2 T A 13: 95,635,633 D1346V probably damaging Het
Kcng3 A T 17: 83,587,737 N433K possibly damaging Het
Kif1a T A 1: 93,052,566 probably benign Het
Lctl C A 9: 64,118,887 Q75K probably benign Het
Ldb3 T A 14: 34,578,651 I89F possibly damaging Het
Lrrc49 A T 9: 60,677,095 L156Q probably damaging Het
Mark2 G T 19: 7,281,828 T83K probably benign Het
Ms4a15 A T 19: 10,980,210 D170E probably damaging Het
Msantd2 A G 9: 37,522,760 S99G possibly damaging Het
Nemf G T 12: 69,353,803 T124N probably benign Het
Nlrp9c A T 7: 26,394,136 F35I possibly damaging Het
Nwd2 A G 5: 63,804,773 I567V probably benign Het
Olfr111 A C 17: 37,530,642 I222L probably benign Het
Olfr1340 A G 4: 118,727,170 I308V probably null Het
Olfr323 T C 11: 58,625,740 Y102C probably damaging Het
Olfr828 T A 9: 18,815,994 Q100L probably damaging Het
Optn C T 2: 5,024,115 G526R probably damaging Het
Pdk4 T C 6: 5,491,138 E209G probably benign Het
Plch1 T C 3: 63,710,978 Q712R probably damaging Het
Pnpla1 T A 17: 28,886,878 V569E possibly damaging Het
Prkar2a A T 9: 108,719,258 D134V probably damaging Het
Ptov1 T A 7: 44,864,622 Q40L possibly damaging Het
Ptprq T C 10: 107,708,728 I314V probably benign Het
Rabl2 T C 15: 89,583,966 K66E probably damaging Het
Rnf38 A G 4: 44,152,507 V19A possibly damaging Het
Scn2a T A 2: 65,682,091 W191R probably damaging Het
Sec22b T A 3: 97,921,256 F212I possibly damaging Het
Sec24c T A 14: 20,688,715 probably null Het
Sept2 T C 1: 93,495,599 S51P probably damaging Het
Serpinb1a T C 13: 32,848,656 N90S probably damaging Het
Slc1a2 C T 2: 102,743,863 T206I probably benign Het
Slc25a19 C A 11: 115,624,206 R42L probably damaging Het
St14 G A 9: 31,091,324 probably benign Het
Stxbp1 C T 2: 32,802,905 probably benign Het
Tas2r131 C T 6: 132,957,829 V6I probably benign Het
Tdo2 T A 3: 81,964,000 M235L probably benign Het
Tenm3 T G 8: 48,232,105 H2432P probably damaging Het
Tmprss15 C T 16: 79,024,742 probably benign Het
Tmx1 A G 12: 70,453,256 N30D probably benign Het
Tom1 A G 8: 75,064,392 probably null Het
Ttc23l T A 15: 10,539,963 T145S probably benign Het
Unc13b T A 4: 43,236,983 M3351K possibly damaging Het
Vmn1r47 T C 6: 90,022,659 S258P probably damaging Het
Vmn2r8 T G 5: 108,797,451 probably null Het
Vps11 T C 9: 44,353,838 Q641R probably null Het
Wapl T A 14: 34,692,324 I381N probably damaging Het
Zmym6 G A 4: 127,122,808 G794E probably damaging Het
Other mutations in Top2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Top2a APN 11 99018821 nonsense probably null
IGL01285:Top2a APN 11 99006159 splice site probably benign
IGL01445:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01451:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01456:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01458:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01481:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01485:Top2a APN 11 99011030 missense probably damaging 1.00
IGL01753:Top2a APN 11 99007274 missense probably damaging 0.97
IGL03029:Top2a APN 11 99018799 missense probably benign 0.03
PIT4581001:Top2a UTSW 11 99002964 missense probably damaging 0.97
PIT4585001:Top2a UTSW 11 99001373 missense probably benign 0.02
R0008:Top2a UTSW 11 99002903 nonsense probably null
R0047:Top2a UTSW 11 98997856 missense probably benign
R0047:Top2a UTSW 11 98997856 missense probably benign
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0070:Top2a UTSW 11 99015060 critical splice acceptor site probably null
R0116:Top2a UTSW 11 99003590 missense probably benign 0.00
R0245:Top2a UTSW 11 99010096 missense probably benign 0.37
R0276:Top2a UTSW 11 99009907 splice site probably benign
R0288:Top2a UTSW 11 99016423 splice site probably benign
R0422:Top2a UTSW 11 99009853 missense probably damaging 1.00
R0546:Top2a UTSW 11 98999226 missense possibly damaging 0.75
R0558:Top2a UTSW 11 98996839 missense probably benign
R0599:Top2a UTSW 11 99001417 missense probably damaging 0.99
R0727:Top2a UTSW 11 99012148 nonsense probably null
R1565:Top2a UTSW 11 99001054 missense probably damaging 0.99
R1674:Top2a UTSW 11 99009273 missense probably damaging 0.96
R1844:Top2a UTSW 11 99016069 missense probably benign 0.06
R1959:Top2a UTSW 11 98995977 splice site probably null
R2124:Top2a UTSW 11 99004228 missense probably benign 0.00
R2128:Top2a UTSW 11 99009807 missense probably damaging 0.97
R3707:Top2a UTSW 11 98996825 missense probably benign 0.13
R4110:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4112:Top2a UTSW 11 99022960 missense probably damaging 1.00
R4423:Top2a UTSW 11 99001405 missense probably benign 0.00
R4425:Top2a UTSW 11 99001405 missense probably benign 0.00
R4914:Top2a UTSW 11 99002960 missense probably damaging 1.00
R4939:Top2a UTSW 11 99010092 missense probably damaging 1.00
R4944:Top2a UTSW 11 98997850 missense probably benign 0.37
R4971:Top2a UTSW 11 98993841 missense probably damaging 1.00
R5362:Top2a UTSW 11 99018912 missense probably damaging 1.00
R5477:Top2a UTSW 11 99016480 nonsense probably null
R5499:Top2a UTSW 11 99022376 missense probably benign 0.20
R5911:Top2a UTSW 11 99016465 missense possibly damaging 0.92
R7126:Top2a UTSW 11 99014992 missense probably benign 0.09
R7131:Top2a UTSW 11 99004182 missense possibly damaging 0.75
R7174:Top2a UTSW 11 99024096 start gained probably benign
R7329:Top2a UTSW 11 99004246 missense possibly damaging 0.57
R7560:Top2a UTSW 11 99000837 missense probably benign
R7563:Top2a UTSW 11 99016179 missense probably damaging 1.00
R7740:Top2a UTSW 11 98993814 missense probably benign 0.34
R7841:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7894:Top2a UTSW 11 99009605 missense probably damaging 1.00
R7924:Top2a UTSW 11 99022350 missense probably damaging 1.00
R7977:Top2a UTSW 11 99009605 missense probably damaging 1.00
U24488:Top2a UTSW 11 99022426 missense probably damaging 1.00
X0025:Top2a UTSW 11 98995941 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AAGCAAGCGCACTTTGCTAGTTTGG -3'
(R):5'- CATCTGTAATCGGCACGAGCCTATG -3'

Sequencing Primer
(F):5'- CGCACTTTGCTAGTTTGGTTTTAC -3'
(R):5'- cagagactgaggcaagagg -3'
Posted On2013-08-08