Incidental Mutation 'R8360:Serpina3b'
ID 652163
Institutional Source Beutler Lab
Gene Symbol Serpina3b
Ensembl Gene ENSMUSG00000066364
Gene Name serine (or cysteine) peptidase inhibitor, clade A, member 3B
Synonyms antitrypsin, A030003A19Rik, alpha-1 antiproteinase, 6A1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R8360 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 104127996-104139545 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 104138703 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 379 (N379K)
Ref Sequence ENSEMBL: ENSMUSP00000082127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085052]
AlphaFold Q8BYY9
Predicted Effect probably benign
Transcript: ENSMUST00000085052
AA Change: N379K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000082127
Gene: ENSMUSG00000066364
AA Change: N379K

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SERPIN 56 417 1.1e-153 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b C T 19: 21,678,524 Q57* probably null Het
Acad8 C T 9: 26,979,056 A288T possibly damaging Het
Adamtsl3 G A 7: 82,547,979 C711Y probably damaging Het
Ahcyl2 C A 6: 29,768,870 D111E probably benign Het
Asxl3 T C 18: 22,516,117 F388L probably benign Het
Bcr T A 10: 75,145,439 S697T probably damaging Het
C77080 C T 4: 129,224,202 R268Q possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Catspere2 G A 1: 178,015,158 V50M possibly damaging Het
Dgka C A 10: 128,728,128 V451F probably damaging Het
Dnajc2 A T 5: 21,757,707 C617S unknown Het
Erich3 C A 3: 154,764,354 T1481K unknown Het
Hdac2 T A 10: 36,998,063 D396E probably benign Het
Hmgcs2 A T 3: 98,297,408 D294V possibly damaging Het
Hnf1a A G 5: 114,953,332 V434A possibly damaging Het
Il4ra T C 7: 125,569,966 L130P probably damaging Het
Inpp5j T C 11: 3,499,767 K672E probably damaging Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Kif26b T C 1: 178,916,373 S1345P probably benign Het
Lrrc28 A T 7: 67,641,161 D37E probably benign Het
Mlx G T 11: 101,087,314 probably benign Het
Muc16 T C 9: 18,525,258 H7878R probably benign Het
Mybpc1 C A 10: 88,573,497 E32* probably null Het
Nebl C T 2: 17,460,487 V18M probably benign Het
Nlrp3 T C 11: 59,549,403 V602A probably benign Het
Npepps G A 11: 97,229,839 P532S probably benign Het
Olfr1055 T C 2: 86,347,324 I147M possibly damaging Het
Olfr27 C T 9: 39,144,465 R122* probably null Het
Olfr834 T A 9: 18,988,843 M285K probably benign Het
Pfdn1 G A 18: 36,451,161 T40M probably benign Het
Pkd2 G T 5: 104,459,787 E51* probably null Het
Prss40 T A 1: 34,560,795 H37L probably benign Het
Rab11fip1 A T 8: 27,152,346 C808* probably null Het
Rab3gap2 A T 1: 185,267,073 probably benign Het
Sall3 C T 18: 80,974,017 R232H probably benign Het
Sbk3 A G 7: 4,967,708 F221L probably damaging Het
Sema7a T G 9: 57,955,691 probably benign Het
Ssbp4 A G 8: 70,599,389 L208P probably benign Het
Stxbp5 C T 10: 9,812,259 probably null Het
Tecrl A G 5: 83,300,917 Y160H probably damaging Het
Tnc T C 4: 63,967,274 I1773V probably benign Het
Ush2a A G 1: 188,466,271 T1511A probably benign Het
Utp15 T C 13: 98,254,991 N246S probably damaging Het
Vmn1r49 C T 6: 90,073,009 A4T probably benign Het
Vmn2r57 A T 7: 41,400,216 I703N probably damaging Het
Wdr93 A G 7: 79,749,226 D36G probably damaging Het
Zfp334 A G 2: 165,383,358 I8T probably benign Het
Other mutations in Serpina3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Serpina3b APN 12 104138787 missense probably benign 0.03
IGL00427:Serpina3b APN 12 104132941 missense probably benign 0.06
IGL01637:Serpina3b APN 12 104132957 missense probably benign 0.00
IGL01738:Serpina3b APN 12 104130832 missense probably damaging 1.00
IGL02403:Serpina3b APN 12 104130462 start codon destroyed probably null 1.00
IGL03118:Serpina3b APN 12 104131054 missense probably benign 0.22
R0141:Serpina3b UTSW 12 104130771 missense probably damaging 1.00
R0217:Serpina3b UTSW 12 104130727 missense probably damaging 1.00
R0437:Serpina3b UTSW 12 104130670 missense probably damaging 1.00
R1295:Serpina3b UTSW 12 104130879 missense probably damaging 1.00
R1463:Serpina3b UTSW 12 104138710 missense probably benign 0.02
R1802:Serpina3b UTSW 12 104138637 missense probably damaging 1.00
R2104:Serpina3b UTSW 12 104138810 missense probably benign 0.01
R3871:Serpina3b UTSW 12 104138788 missense probably damaging 1.00
R4720:Serpina3b UTSW 12 104130630 missense possibly damaging 0.80
R5827:Serpina3b UTSW 12 104130777 missense probably benign 0.02
R5970:Serpina3b UTSW 12 104134091 missense possibly damaging 0.82
R6014:Serpina3b UTSW 12 104131097 missense possibly damaging 0.93
R6102:Serpina3b UTSW 12 104134169 missense probably benign 0.00
R6673:Serpina3b UTSW 12 104130669 missense probably damaging 0.96
R6807:Serpina3b UTSW 12 104132992 missense probably benign 0.00
R6836:Serpina3b UTSW 12 104134082 missense probably benign 0.30
R6893:Serpina3b UTSW 12 104133026 missense probably benign 0.04
R7414:Serpina3b UTSW 12 104132886 missense probably benign 0.03
R7539:Serpina3b UTSW 12 104130711 missense possibly damaging 0.75
R7748:Serpina3b UTSW 12 104130463 start codon destroyed probably null 1.00
R7817:Serpina3b UTSW 12 104132964 missense probably benign 0.01
R8040:Serpina3b UTSW 12 104131076 missense probably benign 0.00
R8143:Serpina3b UTSW 12 104130534 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATTGGCCAGCAGATGAGGC -3'
(R):5'- AGTCAAGGGCACTGTTTGATTAC -3'

Sequencing Primer
(F):5'- CAGCAGATGAGGCCAGCAC -3'
(R):5'- TGCCACAGCCTATGAGAGGG -3'
Posted On 2020-10-20