Incidental Mutation 'R8360:Pfdn1'
ID652166
Institutional Source Beutler Lab
Gene Symbol Pfdn1
Ensembl Gene ENSMUSG00000024346
Gene Nameprefoldin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R8360 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location36403679-36454495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36451161 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 40 (T40M)
Ref Sequence ENSEMBL: ENSMUSP00000025204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025204]
Predicted Effect probably benign
Transcript: ENSMUST00000025204
AA Change: T40M

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025204
Gene: ENSMUSG00000024346
AA Change: T40M

DomainStartEndE-ValueType
Pfam:Prefoldin_2 14 119 1.4e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele display reduced birth size, slow weight gain, loss of neuron tracts in the brain, uncoordinated movement, impaired B and T cell development and function, mucus clearance defects, hydrocephaly, and premature deathpreceded by physical wasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b C T 19: 21,678,524 Q57* probably null Het
Acad8 C T 9: 26,979,056 A288T possibly damaging Het
Adamtsl3 G A 7: 82,547,979 C711Y probably damaging Het
Ahcyl2 C A 6: 29,768,870 D111E probably benign Het
Asxl3 T C 18: 22,516,117 F388L probably benign Het
Bcr T A 10: 75,145,439 S697T probably damaging Het
C77080 C T 4: 129,224,202 R268Q possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Catspere2 G A 1: 178,015,158 V50M possibly damaging Het
Dgka C A 10: 128,728,128 V451F probably damaging Het
Dnajc2 A T 5: 21,757,707 C617S unknown Het
Erich3 C A 3: 154,764,354 T1481K unknown Het
Hdac2 T A 10: 36,998,063 D396E probably benign Het
Hmgcs2 A T 3: 98,297,408 D294V possibly damaging Het
Hnf1a A G 5: 114,953,332 V434A possibly damaging Het
Il4ra T C 7: 125,569,966 L130P probably damaging Het
Inpp5j T C 11: 3,499,767 K672E probably damaging Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Kif26b T C 1: 178,916,373 S1345P probably benign Het
Lrrc28 A T 7: 67,641,161 D37E probably benign Het
Mlx G T 11: 101,087,314 probably benign Het
Muc16 T C 9: 18,525,258 H7878R probably benign Het
Mybpc1 C A 10: 88,573,497 E32* probably null Het
Nebl C T 2: 17,460,487 V18M probably benign Het
Nlrp3 T C 11: 59,549,403 V602A probably benign Het
Npepps G A 11: 97,229,839 P532S probably benign Het
Olfr1055 T C 2: 86,347,324 I147M possibly damaging Het
Olfr27 C T 9: 39,144,465 R122* probably null Het
Olfr834 T A 9: 18,988,843 M285K probably benign Het
Pkd2 G T 5: 104,459,787 E51* probably null Het
Prss40 T A 1: 34,560,795 H37L probably benign Het
Rab11fip1 A T 8: 27,152,346 C808* probably null Het
Rab3gap2 A T 1: 185,267,073 probably benign Het
Sall3 C T 18: 80,974,017 R232H probably benign Het
Sbk3 A G 7: 4,967,708 F221L probably damaging Het
Sema7a T G 9: 57,955,691 probably benign Het
Serpina3b C A 12: 104,138,703 N379K probably benign Het
Ssbp4 A G 8: 70,599,389 L208P probably benign Het
Stxbp5 C T 10: 9,812,259 probably null Het
Tecrl A G 5: 83,300,917 Y160H probably damaging Het
Tnc T C 4: 63,967,274 I1773V probably benign Het
Ush2a A G 1: 188,466,271 T1511A probably benign Het
Utp15 T C 13: 98,254,991 N246S probably damaging Het
Vmn1r49 C T 6: 90,073,009 A4T probably benign Het
Vmn2r57 A T 7: 41,400,216 I703N probably damaging Het
Wdr93 A G 7: 79,749,226 D36G probably damaging Het
Zfp334 A G 2: 165,383,358 I8T probably benign Het
Other mutations in Pfdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1857:Pfdn1 UTSW 18 36451100 missense probably benign 0.00
R1858:Pfdn1 UTSW 18 36451100 missense probably benign 0.00
R1859:Pfdn1 UTSW 18 36451100 missense probably benign 0.00
R3809:Pfdn1 UTSW 18 36451092 missense probably damaging 1.00
R4690:Pfdn1 UTSW 18 36451080 missense possibly damaging 0.56
R5082:Pfdn1 UTSW 18 36404413 missense probably damaging 1.00
R7107:Pfdn1 UTSW 18 36451466 splice site probably null
R7747:Pfdn1 UTSW 18 36432305 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACCTGGGGTTTTATGCC -3'
(R):5'- GCTTTGTCAAGTTAGCATGATCTG -3'

Sequencing Primer
(F):5'- GTGCGCTGATTTACTCAC -3'
(R):5'- GTCAAGTTAGCATGATCTGTTTTAAC -3'
Posted On2020-10-20