Incidental Mutation 'R8360:Sall3'
ID652167
Institutional Source Beutler Lab
Gene Symbol Sall3
Ensembl Gene ENSMUSG00000024565
Gene Namespalt like transcription factor 3
SynonymsMsal, Spalt, Msal-1, Salt, B130022O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8360 (G1)
Quality Score193.009
Status Validated
Chromosome18
Chromosomal Location80966376-80986578 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 80974017 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 232 (R232H)
Ref Sequence ENSEMBL: ENSMUSP00000056967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057950]
Predicted Effect probably benign
Transcript: ENSMUST00000057950
AA Change: R232H

PolyPhen 2 Score 0.306 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056967
Gene: ENSMUSG00000024565
AA Change: R232H

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 210 231 N/A INTRINSIC
low complexity region 271 289 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 350 371 N/A INTRINSIC
ZnF_C2H2 427 449 2.57e-3 SMART
ZnF_C2H2 455 477 3.21e-4 SMART
low complexity region 555 568 N/A INTRINSIC
ZnF_C2H2 692 714 3.99e0 SMART
ZnF_C2H2 720 742 2.99e-4 SMART
ZnF_C2H2 752 774 1.6e-4 SMART
low complexity region 834 852 N/A INTRINSIC
low complexity region 901 923 N/A INTRINSIC
low complexity region 993 1007 N/A INTRINSIC
ZnF_C2H2 1061 1083 1.69e-3 SMART
ZnF_C2H2 1089 1111 5.99e-4 SMART
Meta Mutation Damage Score 0.2203 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sal-like C2H2-type zinc-finger protein, and belongs to a family of evolutionarily conserved genes found in species as diverse as Drosophila, C. elegans, and vertebrates. Mutations in some of these genes are associated with congenital disorders in human, suggesting their importance in embryonic development. This protein binds to DNA methyltransferase 3 alpha (DNMT3A), and reduces DNMT3A-mediated CpG island methylation. It is suggested that silencing of this gene, resulting in acceleration of DNA methylation, may have a role in oncogenesis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display neonatal lethality with an impaired suckling ability, truncated soft palate, small epiglottis, and abnormal cranial nerve morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b C T 19: 21,678,524 Q57* probably null Het
Acad8 C T 9: 26,979,056 A288T possibly damaging Het
Adamtsl3 G A 7: 82,547,979 C711Y probably damaging Het
Ahcyl2 C A 6: 29,768,870 D111E probably benign Het
Asxl3 T C 18: 22,516,117 F388L probably benign Het
Bcr T A 10: 75,145,439 S697T probably damaging Het
C77080 C T 4: 129,224,202 R268Q possibly damaging Het
Casc4 A T 2: 121,867,151 probably benign Het
Catspere2 G A 1: 178,015,158 V50M possibly damaging Het
Dgka C A 10: 128,728,128 V451F probably damaging Het
Dnajc2 A T 5: 21,757,707 C617S unknown Het
Erich3 C A 3: 154,764,354 T1481K unknown Het
Hdac2 T A 10: 36,998,063 D396E probably benign Het
Hmgcs2 A T 3: 98,297,408 D294V possibly damaging Het
Hnf1a A G 5: 114,953,332 V434A possibly damaging Het
Il4ra T C 7: 125,569,966 L130P probably damaging Het
Inpp5j T C 11: 3,499,767 K672E probably damaging Het
Kif16b G A 2: 142,711,857 A1007V probably benign Het
Kif26b T C 1: 178,916,373 S1345P probably benign Het
Lrrc28 A T 7: 67,641,161 D37E probably benign Het
Mlx G T 11: 101,087,314 probably benign Het
Muc16 T C 9: 18,525,258 H7878R probably benign Het
Mybpc1 C A 10: 88,573,497 E32* probably null Het
Nebl C T 2: 17,460,487 V18M probably benign Het
Nlrp3 T C 11: 59,549,403 V602A probably benign Het
Npepps G A 11: 97,229,839 P532S probably benign Het
Olfr1055 T C 2: 86,347,324 I147M possibly damaging Het
Olfr27 C T 9: 39,144,465 R122* probably null Het
Olfr834 T A 9: 18,988,843 M285K probably benign Het
Pfdn1 G A 18: 36,451,161 T40M probably benign Het
Pkd2 G T 5: 104,459,787 E51* probably null Het
Prss40 T A 1: 34,560,795 H37L probably benign Het
Rab11fip1 A T 8: 27,152,346 C808* probably null Het
Rab3gap2 A T 1: 185,267,073 probably benign Het
Sbk3 A G 7: 4,967,708 F221L probably damaging Het
Sema7a T G 9: 57,955,691 probably benign Het
Serpina3b C A 12: 104,138,703 N379K probably benign Het
Ssbp4 A G 8: 70,599,389 L208P probably benign Het
Stxbp5 C T 10: 9,812,259 probably null Het
Tecrl A G 5: 83,300,917 Y160H probably damaging Het
Tnc T C 4: 63,967,274 I1773V probably benign Het
Ush2a A G 1: 188,466,271 T1511A probably benign Het
Utp15 T C 13: 98,254,991 N246S probably damaging Het
Vmn1r49 C T 6: 90,073,009 A4T probably benign Het
Vmn2r57 A T 7: 41,400,216 I703N probably damaging Het
Wdr93 A G 7: 79,749,226 D36G probably damaging Het
Zfp334 A G 2: 165,383,358 I8T probably benign Het
Other mutations in Sall3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Sall3 APN 18 80973232 missense probably damaging 0.98
IGL01630:Sall3 APN 18 80971269 missense probably benign 0.03
IGL01713:Sall3 APN 18 80969847 missense probably damaging 1.00
IGL01803:Sall3 APN 18 80969832 missense possibly damaging 0.65
IGL02627:Sall3 APN 18 80972361 missense possibly damaging 0.86
IGL02858:Sall3 APN 18 80969513 missense probably damaging 1.00
IGL03177:Sall3 APN 18 80972968 missense probably benign 0.00
fountain UTSW 18 80974476 missense probably damaging 0.99
IGL02984:Sall3 UTSW 18 80973450 missense probably benign 0.01
R1055:Sall3 UTSW 18 80969792 missense probably benign 0.24
R1258:Sall3 UTSW 18 80974065 missense probably damaging 1.00
R1932:Sall3 UTSW 18 80969753 missense probably benign 0.44
R1976:Sall3 UTSW 18 80971893 missense probably benign 0.42
R2124:Sall3 UTSW 18 80971797 missense probably benign 0.01
R2142:Sall3 UTSW 18 80969831 missense probably damaging 0.98
R2199:Sall3 UTSW 18 80971870 missense probably benign 0.27
R2365:Sall3 UTSW 18 80971792 missense probably benign 0.01
R3856:Sall3 UTSW 18 80972502 missense probably damaging 1.00
R4022:Sall3 UTSW 18 80969840 missense probably benign 0.05
R4050:Sall3 UTSW 18 80971482 missense probably benign 0.03
R4085:Sall3 UTSW 18 80972133 missense probably damaging 0.99
R4764:Sall3 UTSW 18 80974476 missense probably damaging 0.99
R4874:Sall3 UTSW 18 80973973 missense probably benign 0.33
R4948:Sall3 UTSW 18 80971411 missense probably benign 0.20
R5274:Sall3 UTSW 18 80969837 missense probably benign 0.15
R5602:Sall3 UTSW 18 80972812 missense probably benign
R6063:Sall3 UTSW 18 80974255 missense possibly damaging 0.52
R6256:Sall3 UTSW 18 80969861 missense possibly damaging 0.74
R6431:Sall3 UTSW 18 80973187 missense possibly damaging 0.94
R6523:Sall3 UTSW 18 80973188 missense possibly damaging 0.68
R6719:Sall3 UTSW 18 80971506 missense probably damaging 0.99
R6861:Sall3 UTSW 18 80974375 nonsense probably null
R7078:Sall3 UTSW 18 80974099 missense probably damaging 0.97
R7107:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7108:Sall3 UTSW 18 80973754 missense probably benign 0.01
R7453:Sall3 UTSW 18 80972040 missense probably benign 0.07
R7491:Sall3 UTSW 18 80972705 missense probably benign 0.03
R7496:Sall3 UTSW 18 80973364 missense probably benign 0.07
R7584:Sall3 UTSW 18 80974530 missense probably benign 0.00
R7599:Sall3 UTSW 18 80972052 missense possibly damaging 0.56
R7809:Sall3 UTSW 18 80974360 missense probably benign 0.00
R8244:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8245:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8250:Sall3 UTSW 18 80973528 missense probably benign 0.01
R8335:Sall3 UTSW 18 80969586 missense probably benign 0.35
R8410:Sall3 UTSW 18 80973754 missense probably benign 0.01
R8476:Sall3 UTSW 18 80972118 nonsense probably null
R8712:Sall3 UTSW 18 80974021 missense probably benign 0.03
R8726:Sall3 UTSW 18 80986493 missense possibly damaging 0.89
Z1176:Sall3 UTSW 18 80972760 missense probably benign 0.19
Z1177:Sall3 UTSW 18 80974276 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGCCTACAGTGCTGGATGC -3'
(R):5'- TACCAATGTGACCCTGGAGACG -3'

Sequencing Primer
(F):5'- TGTGCCCCAGAATCAGGG -3'
(R):5'- CTGGAGACGCTGCTCAG -3'
Posted On2020-10-20