Incidental Mutation 'R8401:Spi1'
ID652176
Institutional Source Beutler Lab
Gene Symbol Spi1
Ensembl Gene ENSMUSG00000002111
Gene Namespleen focus forming virus (SFFV) proviral integration oncogene
SynonymsSfpi-1, Dis-1, Tcfpu1, PU.1, Spi-1, Sfpi1, Tfpu.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8401 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location91082390-91115756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91113305 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 65 (N65D)
Ref Sequence ENSEMBL: ENSMUSP00000002180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002180] [ENSMUST00000111430] [ENSMUST00000132741] [ENSMUST00000137942] [ENSMUST00000169776] [ENSMUST00000169852]
PDB Structure PU.1 ETS DOMAIN-DNA COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000002180
AA Change: N65D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000002180
Gene: ENSMUSG00000002111
AA Change: N65D

DomainStartEndE-ValueType
low complexity region 56 73 N/A INTRINSIC
low complexity region 78 85 N/A INTRINSIC
low complexity region 154 167 N/A INTRINSIC
ETS 171 259 9.71e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111430
SMART Domains Protein: ENSMUSP00000107058
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 373 453 1.25e-4 SMART
IG 463 544 2.48e-8 SMART
IG 554 640 3.16e-1 SMART
IG 659 772 3.91e-6 SMART
FN3 775 858 2.5e-11 SMART
FN3 873 956 7.06e-11 SMART
IG 983 1066 3.3e-4 SMART
FN3 1069 1151 4.38e-7 SMART
IGc2 1196 1263 6.21e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132741
AA Change: N75D

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000137942
SMART Domains Protein: ENSMUSP00000119994
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 3 99 2.81e-7 SMART
low complexity region 135 152 N/A INTRINSIC
IG 209 289 1.25e-4 SMART
IG 299 380 2.48e-8 SMART
IG 390 476 3.16e-1 SMART
IG 495 608 3.91e-6 SMART
FN3 611 694 2.5e-11 SMART
FN3 709 792 7.06e-11 SMART
IG 819 902 3.3e-4 SMART
FN3 905 987 4.38e-7 SMART
IGc2 1032 1099 6.21e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169776
SMART Domains Protein: ENSMUSP00000127070
Gene: ENSMUSG00000002100

DomainStartEndE-ValueType
IG 24 103 4.86e-2 SMART
low complexity region 131 143 N/A INTRINSIC
IG 167 263 2.81e-7 SMART
IG 374 454 1.25e-4 SMART
IG 464 545 2.48e-8 SMART
IG 555 641 3.16e-1 SMART
IG 660 773 3.91e-6 SMART
FN3 776 859 2.5e-11 SMART
FN3 874 957 7.06e-11 SMART
IG 984 1067 3.3e-4 SMART
FN3 1070 1152 4.38e-7 SMART
IGc2 1197 1264 6.21e-9 SMART
Predicted Effect silent
Transcript: ENSMUST00000169852
SMART Domains Protein: ENSMUSP00000130368
Gene: ENSMUSG00000002111

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 123 133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ETS-domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development. The nuclear protein binds to a purine-rich sequence known as the PU-box found near the promoters of target genes, and regulates their expression in coordination with other transcription factors and cofactors. The protein can also regulate alternative splicing of target genes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit fetal or perinatal lethality, absence of myeloid and B cells, and altered T cell and NK cell development. Mice carrying hypomorphic alleles display impaired B-cell and myeloid development, develop T cell derived lymphomas andacute myeloid leukemia, and die prematurely. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 T C 14: 31,745,294 Y207C probably damaging Het
Ano8 T C 8: 71,483,367 D235G probably damaging Het
Atp2b4 T A 1: 133,731,836 I463F probably damaging Het
Brca2 T A 5: 150,552,352 I2509N probably damaging Het
Brinp3 T C 1: 146,901,446 S544P probably benign Het
Chd1 A G 17: 15,743,211 Y824C probably damaging Het
Dapk1 T C 13: 60,723,090 V330A probably benign Het
Dct T C 14: 118,043,203 T134A possibly damaging Het
Ddx56 T C 11: 6,264,199 D350G probably damaging Het
Ddx60 C T 8: 61,956,243 L438F possibly damaging Het
Dnah17 T A 11: 118,024,659 K4378M probably damaging Het
Drc7 C T 8: 95,074,135 S595F probably benign Het
Epb41 C T 4: 131,974,707 R539Q probably damaging Het
Foxred2 T C 15: 77,951,991 I389V probably damaging Het
Gan C A 8: 117,183,503 T57K possibly damaging Het
Glra3 T C 8: 56,089,089 V289A probably damaging Het
Grk1 T C 8: 13,407,846 F249L probably damaging Het
Grk6 G A 13: 55,452,168 A258T possibly damaging Het
Hars T C 18: 36,771,190 N212S possibly damaging Het
Ikzf2 C A 1: 69,539,095 Q418H probably damaging Het
Ikzf2 T G 1: 69,539,096 Q418P probably damaging Het
Klre1 T A 6: 129,580,026 N30K probably benign Het
Lama5 G T 2: 180,198,787 D606E probably damaging Het
Lca5l T C 16: 96,162,560 K393R probably damaging Het
Lmbrd2 A T 15: 9,156,207 I124F possibly damaging Het
Loxhd1 C A 18: 77,380,460 P935T probably damaging Het
Nes T C 3: 87,978,081 S1216P possibly damaging Het
Nim1k A G 13: 119,712,677 L227P probably damaging Het
Nkx2-1 C A 12: 56,533,056 L366F probably damaging Het
Nol6 C A 4: 41,119,548 R586L possibly damaging Het
Ogdh T A 11: 6,297,174 L66* probably null Het
Olfr1367 A T 13: 21,347,827 I300L probably benign Het
Orm3 A G 4: 63,356,230 S11G possibly damaging Het
Pkn3 C A 2: 30,080,059 S126R probably benign Het
Pnpla8 T A 12: 44,288,308 D442E probably damaging Het
Pop1 A T 15: 34,508,609 T277S probably damaging Het
Prkag2 T C 5: 24,863,870 T563A probably benign Het
Prkdc T A 16: 15,773,613 F2652I possibly damaging Het
Prok1 A G 3: 107,237,197 I30T probably benign Het
Prr9 T G 3: 92,123,049 T95P possibly damaging Het
Ptgds A G 2: 25,469,657 M6T unknown Het
Rnaseh2b T A 14: 62,370,489 D250E probably benign Het
Rundc1 C T 11: 101,433,557 T363M probably damaging Het
Ryr2 T A 13: 11,668,935 H3081L possibly damaging Het
Setmar T C 6: 108,076,163 I206T probably benign Het
Slitrk6 A G 14: 110,752,021 S85P possibly damaging Het
Stx1b A T 7: 127,807,773 probably benign Het
Trav5-4 G A 14: 53,704,293 S41N probably benign Het
Tspan14 T C 14: 40,908,092 D260G probably benign Het
Ube4a T C 9: 44,941,229 D645G possibly damaging Het
Ush2a C T 1: 188,542,865 T1845I probably benign Het
Vps18 T C 2: 119,297,492 L932P probably damaging Het
Wdr61 A T 9: 54,728,255 S21T probably benign Het
Zfp62 T A 11: 49,217,391 C770S probably damaging Het
Zfp672 T C 11: 58,316,802 K231R probably benign Het
Other mutations in Spi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02591:Spi1 APN 2 91096950 start codon destroyed probably null 0.93
R1778:Spi1 UTSW 2 91099522 missense probably damaging 1.00
R1893:Spi1 UTSW 2 91114357 missense probably benign 0.04
R4230:Spi1 UTSW 2 91115335 missense probably damaging 1.00
R5169:Spi1 UTSW 2 91115083 nonsense probably null
R6025:Spi1 UTSW 2 91114340 missense probably benign
R6877:Spi1 UTSW 2 91114396 missense probably damaging 0.98
R7052:Spi1 UTSW 2 91113340 missense probably damaging 1.00
R8725:Spi1 UTSW 2 91115171 missense probably damaging 1.00
X0019:Spi1 UTSW 2 91096985 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TCCGTGAATGTTCCAGGAGATG -3'
(R):5'- CTGTGAAGGTTCCATGCCTCAC -3'

Sequencing Primer
(F):5'- GGAGATGATTAACGTACTTTCTGCCC -3'
(R):5'- GGTTCCATGCCTCACCACAG -3'
Posted On2020-10-20