Mutagenetix > Incidental Mutation

Incidental Mutation 'R8401:Vps18'

652177

Institutional Source

Beutler Lab

Gene Symbol

Vps18

Ensembl Gene

ENSMUSG00000034216

Gene Name

VPS18 CORVET/HOPS core subunit

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8401 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119288740-119298453 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 119297492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 932 (L932P)

Ref Sequence

ENSEMBL: ENSMUSP00000036915 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037280]

AlphaFold

Q8R307

Predicted Effect

probably damaging
Transcript: ENSMUST00000037280
AA Change: L932P

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000036915
Gene: ENSMUSG00000034216
AA Change: L932P

Domain	Start	End	E-Value	Type
Pfam:Pep3_Vps18	291	435	2.4e-41	PFAM
low complexity region	486	500	N/A	INTRINSIC
Pfam:Clathrin	619	771	5.9e-11	PFAM
coiled coil region	803	845	N/A	INTRINSIC
Blast:RING	853	947	3e-47	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.3%

Validation Efficiency

98% (55/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps18 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in the nervous system exhibit impaired neuron migration and neurodegeneration associated with increased apoptosis and impaired autophagy and endocytosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd28	T	C	14: 31,745,294	Y207C	probably damaging	Het
Ano8	T	C	8: 71,483,367	D235G	probably damaging	Het
Atp2b4	T	A	1: 133,731,836	I463F	probably damaging	Het
Brca2	T	A	5: 150,552,352	I2509N	probably damaging	Het
Brinp3	T	C	1: 146,901,446	S544P	probably benign	Het
Chd1	A	G	17: 15,743,211	Y824C	probably damaging	Het
Dapk1	T	C	13: 60,723,090	V330A	probably benign	Het
Dct	T	C	14: 118,043,203	T134A	possibly damaging	Het
Ddx56	T	C	11: 6,264,199	D350G	probably damaging	Het
Ddx60	C	T	8: 61,956,243	L438F	possibly damaging	Het
Dnah17	T	A	11: 118,024,659	K4378M	probably damaging	Het
Drc7	C	T	8: 95,074,135	S595F	probably benign	Het
Epb41	C	T	4: 131,974,707	R539Q	probably damaging	Het
Foxred2	T	C	15: 77,951,991	I389V	probably damaging	Het
Gan	C	A	8: 117,183,503	T57K	possibly damaging	Het
Glra3	T	C	8: 56,089,089	V289A	probably damaging	Het
Grk1	T	C	8: 13,407,846	F249L	probably damaging	Het
Grk6	G	A	13: 55,452,168	A258T	possibly damaging	Het
Hars	T	C	18: 36,771,190	N212S	possibly damaging	Het
Ikzf2	C	A	1: 69,539,095	Q418H	probably damaging	Het
Ikzf2	T	G	1: 69,539,096	Q418P	probably damaging	Het
Klre1	T	A	6: 129,580,026	N30K	probably benign	Het
Lama5	G	T	2: 180,198,787	D606E	probably damaging	Het
Lca5l	T	C	16: 96,162,560	K393R	probably damaging	Het
Lmbrd2	A	T	15: 9,156,207	I124F	possibly damaging	Het
Loxhd1	C	A	18: 77,380,460	P935T	probably damaging	Het
Nes	T	C	3: 87,978,081	S1216P	possibly damaging	Het
Nim1k	A	G	13: 119,712,677	L227P	probably damaging	Het
Nkx2-1	C	A	12: 56,533,056	L366F	probably damaging	Het
Nol6	C	A	4: 41,119,548	R586L	possibly damaging	Het
Ogdh	T	A	11: 6,297,174	L66*	probably null	Het
Olfr1367	A	T	13: 21,347,827	I300L	probably benign	Het
Orm3	A	G	4: 63,356,230	S11G	possibly damaging	Het
Pkn3	C	A	2: 30,080,059	S126R	probably benign	Het
Pnpla8	T	A	12: 44,288,308	D442E	probably damaging	Het
Pop1	A	T	15: 34,508,609	T277S	probably damaging	Het
Prkag2	T	C	5: 24,863,870	T563A	probably benign	Het
Prkdc	T	A	16: 15,773,613	F2652I	possibly damaging	Het
Prok1	A	G	3: 107,237,197	I30T	probably benign	Het
Prr9	T	G	3: 92,123,049	T95P	possibly damaging	Het
Ptgds	A	G	2: 25,469,657	M6T	unknown	Het
Rnaseh2b	T	A	14: 62,370,489	D250E	probably benign	Het
Rundc1	C	T	11: 101,433,557	T363M	probably damaging	Het
Ryr2	T	A	13: 11,668,935	H3081L	possibly damaging	Het
Setmar	T	C	6: 108,076,163	I206T	probably benign	Het
Slitrk6	A	G	14: 110,752,021	S85P	possibly damaging	Het
Spi1	A	G	2: 91,113,305	N65D	probably benign	Het
Stx1b	A	T	7: 127,807,773		probably benign	Het
Trav5-4	G	A	14: 53,704,293	S41N	probably benign	Het
Tspan14	T	C	14: 40,908,092	D260G	probably benign	Het
Ube4a	T	C	9: 44,941,229	D645G	possibly damaging	Het
Ush2a	C	T	1: 188,542,865	T1845I	probably benign	Het
Wdr61	A	T	9: 54,728,255	S21T	probably benign	Het
Zfp62	T	A	11: 49,217,391	C770S	probably damaging	Het
Zfp672	T	C	11: 58,316,802	K231R	probably benign	Het

Other mutations in Vps18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01627:Vps18	APN	2	119297191	missense	probably benign	0.03
IGL02311:Vps18	APN	2	119290251	missense	probably benign	0.05
IGL02332:Vps18	APN	2	119293810	missense	probably benign	0.04
IGL03089:Vps18	APN	2	119293177	missense	probably benign	0.01
IGL03114:Vps18	APN	2	119293651	missense	possibly damaging	0.55
IGL03334:Vps18	APN	2	119297482	missense	probably damaging	1.00
F5770:Vps18	UTSW	2	119297228	missense	probably benign	0.22
R0311:Vps18	UTSW	2	119297365	missense	probably benign	0.05
R0346:Vps18	UTSW	2	119297164	missense	probably damaging	1.00
R0373:Vps18	UTSW	2	119293905	missense	probably damaging	0.99
R0637:Vps18	UTSW	2	119293905	missense	probably damaging	0.99
R1493:Vps18	UTSW	2	119297132	missense	probably damaging	1.00
R1703:Vps18	UTSW	2	119289057	missense	probably benign	0.03
R1734:Vps18	UTSW	2	119293942	missense	probably benign	0.01
R4297:Vps18	UTSW	2	119297331	nonsense	probably null
R4633:Vps18	UTSW	2	119293276	missense	probably damaging	1.00
R4729:Vps18	UTSW	2	119293791	missense	probably damaging	1.00
R5034:Vps18	UTSW	2	119293306	missense	probably benign	0.00
R5162:Vps18	UTSW	2	119292942	missense	probably benign	0.19
R5320:Vps18	UTSW	2	119297377	nonsense	probably null
R5857:Vps18	UTSW	2	119297533	missense	probably damaging	1.00
R6105:Vps18	UTSW	2	119289062	missense	probably damaging	1.00
R6150:Vps18	UTSW	2	119297592	nonsense	probably null
R7934:Vps18	UTSW	2	119293641	missense	probably benign	0.11
R8018:Vps18	UTSW	2	119294011	missense	probably damaging	1.00
R8147:Vps18	UTSW	2	119292756	missense	probably benign	0.19
R8525:Vps18	UTSW	2	119290230	missense	possibly damaging	0.68
R9044:Vps18	UTSW	2	119297553	missense	probably damaging	1.00
R9719:Vps18	UTSW	2	119297072	missense	probably damaging	1.00
RF002:Vps18	UTSW	2	119297390	missense	probably damaging	1.00
V7583:Vps18	UTSW	2	119297228	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- ACAAATGCTCCACCTGTGAC -3'
(R):5'- CAGCTGGATCCATGTCTGTC -3'

Sequencing Primer
(F):5'- GTGGCCACATGTTTCACG -3'
(R):5'- ATGTCTGTCCACCCACGCG -3'

Posted On

2020-10-20