Incidental Mutation 'R8401:Setmar'
ID652187
Institutional Source Beutler Lab
Gene Symbol Setmar
Ensembl Gene ENSMUSG00000034639
Gene NameSET domain without mariner transposase fusion
Synonyms5830404F24Rik, Etet2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8401 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location108065045-108077122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108076163 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 206 (I206T)
Ref Sequence ENSEMBL: ENSMUSP00000048225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049246] [ENSMUST00000138140]
Predicted Effect probably benign
Transcript: ENSMUST00000049246
AA Change: I206T

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000048225
Gene: ENSMUSG00000034639
AA Change: I206T

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Pre-SET 29 132 3.7e-14 PFAM
SET 140 270 6.05e-40 SMART
PostSET 284 300 1.69e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138140
SMART Domains Protein: ENSMUSP00000145263
Gene: ENSMUSG00000034639

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: This gene encodes a histone-lysine N-methyltransferase that may be involved in the methylation of histone H3. In anthropoid primates this gene is a fusion gene of a SET histone-lysine N-methyltransferase and a mariner (MAR) family transposase. In all other species this gene contains only the SET domain. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 T C 14: 31,745,294 Y207C probably damaging Het
Ano8 T C 8: 71,483,367 D235G probably damaging Het
Atp2b4 T A 1: 133,731,836 I463F probably damaging Het
Brca2 T A 5: 150,552,352 I2509N probably damaging Het
Brinp3 T C 1: 146,901,446 S544P probably benign Het
Chd1 A G 17: 15,743,211 Y824C probably damaging Het
Dapk1 T C 13: 60,723,090 V330A probably benign Het
Dct T C 14: 118,043,203 T134A possibly damaging Het
Ddx56 T C 11: 6,264,199 D350G probably damaging Het
Ddx60 C T 8: 61,956,243 L438F possibly damaging Het
Dnah17 T A 11: 118,024,659 K4378M probably damaging Het
Drc7 C T 8: 95,074,135 S595F probably benign Het
Epb41 C T 4: 131,974,707 R539Q probably damaging Het
Foxred2 T C 15: 77,951,991 I389V probably damaging Het
Gan C A 8: 117,183,503 T57K possibly damaging Het
Glra3 T C 8: 56,089,089 V289A probably damaging Het
Grk1 T C 8: 13,407,846 F249L probably damaging Het
Grk6 G A 13: 55,452,168 A258T possibly damaging Het
Hars T C 18: 36,771,190 N212S possibly damaging Het
Ikzf2 C A 1: 69,539,095 Q418H probably damaging Het
Ikzf2 T G 1: 69,539,096 Q418P probably damaging Het
Klre1 T A 6: 129,580,026 N30K probably benign Het
Lama5 G T 2: 180,198,787 D606E probably damaging Het
Lca5l T C 16: 96,162,560 K393R probably damaging Het
Lmbrd2 A T 15: 9,156,207 I124F possibly damaging Het
Loxhd1 C A 18: 77,380,460 P935T probably damaging Het
Nes T C 3: 87,978,081 S1216P possibly damaging Het
Nim1k A G 13: 119,712,677 L227P probably damaging Het
Nkx2-1 C A 12: 56,533,056 L366F probably damaging Het
Nol6 C A 4: 41,119,548 R586L possibly damaging Het
Ogdh T A 11: 6,297,174 L66* probably null Het
Olfr1367 A T 13: 21,347,827 I300L probably benign Het
Orm3 A G 4: 63,356,230 S11G possibly damaging Het
Pkn3 C A 2: 30,080,059 S126R probably benign Het
Pnpla8 T A 12: 44,288,308 D442E probably damaging Het
Pop1 A T 15: 34,508,609 T277S probably damaging Het
Prkag2 T C 5: 24,863,870 T563A probably benign Het
Prkdc T A 16: 15,773,613 F2652I possibly damaging Het
Prok1 A G 3: 107,237,197 I30T probably benign Het
Prr9 T G 3: 92,123,049 T95P possibly damaging Het
Ptgds A G 2: 25,469,657 M6T unknown Het
Rnaseh2b T A 14: 62,370,489 D250E probably benign Het
Rundc1 C T 11: 101,433,557 T363M probably damaging Het
Ryr2 T A 13: 11,668,935 H3081L possibly damaging Het
Slitrk6 A G 14: 110,752,021 S85P possibly damaging Het
Spi1 A G 2: 91,113,305 N65D probably benign Het
Stx1b A T 7: 127,807,773 probably benign Het
Trav5-4 G A 14: 53,704,293 S41N probably benign Het
Tspan14 T C 14: 40,908,092 D260G probably benign Het
Ube4a T C 9: 44,941,229 D645G possibly damaging Het
Ush2a C T 1: 188,542,865 T1845I probably benign Het
Vps18 T C 2: 119,297,492 L932P probably damaging Het
Wdr61 A T 9: 54,728,255 S21T probably benign Het
Zfp62 T A 11: 49,217,391 C770S probably damaging Het
Zfp672 T C 11: 58,316,802 K231R probably benign Het
Other mutations in Setmar
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0032:Setmar UTSW 6 108076416 nonsense probably null
R0403:Setmar UTSW 6 108075962 missense probably benign 0.00
R1609:Setmar UTSW 6 108076115 missense probably benign 0.02
R6006:Setmar UTSW 6 108076426 missense possibly damaging 0.92
R7169:Setmar UTSW 6 108065088 missense possibly damaging 0.93
R7733:Setmar UTSW 6 108076127 missense probably damaging 1.00
R8501:Setmar UTSW 6 108075861 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCCAGGTGTTCCAGACAGAG -3'
(R):5'- AACAAGGCTTTCGTGGTGGG -3'

Sequencing Primer
(F):5'- CCCAAGGGAAGATTTGTC -3'
(R):5'- GGAATCTTCCTGAATAGTCGTAAGAG -3'
Posted On2020-10-20