Incidental Mutation 'R8401:Grk1'
ID652189
Institutional Source Beutler Lab
Gene Symbol Grk1
Ensembl Gene ENSMUSG00000031450
Gene NameG protein-coupled receptor kinase 1
SynonymsRK, Rhok
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8401 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13405081-13421951 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13407846 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 249 (F249L)
Ref Sequence ENSEMBL: ENSMUSP00000033827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033827] [ENSMUST00000209909]
Predicted Effect probably damaging
Transcript: ENSMUST00000033827
AA Change: F249L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033827
Gene: ENSMUSG00000031450
AA Change: F249L

DomainStartEndE-ValueType
RGS 57 175 7.34e-35 SMART
S_TKc 190 455 3.42e-81 SMART
S_TK_X 456 535 3.21e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000209909
AA Change: F249L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates rhodopsin and initiates its deactivation. Defects in GRK1 are known to cause Oguchi disease 2 (also known as stationary night blindness Oguchi type-2). [provided by RefSeq, Jul 2008]
PHENOTYPE: Analysis of homozygous null mice revealed abnormal photoresponses and light-induced apoptosis in rods. Mutant mice may serve as models of Oguchi disease and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 T C 14: 31,745,294 Y207C probably damaging Het
Ano8 T C 8: 71,483,367 D235G probably damaging Het
Atp2b4 T A 1: 133,731,836 I463F probably damaging Het
Brca2 T A 5: 150,552,352 I2509N probably damaging Het
Brinp3 T C 1: 146,901,446 S544P probably benign Het
Chd1 A G 17: 15,743,211 Y824C probably damaging Het
Dapk1 T C 13: 60,723,090 V330A probably benign Het
Dct T C 14: 118,043,203 T134A possibly damaging Het
Ddx56 T C 11: 6,264,199 D350G probably damaging Het
Ddx60 C T 8: 61,956,243 L438F possibly damaging Het
Dnah17 T A 11: 118,024,659 K4378M probably damaging Het
Drc7 C T 8: 95,074,135 S595F probably benign Het
Epb41 C T 4: 131,974,707 R539Q probably damaging Het
Foxred2 T C 15: 77,951,991 I389V probably damaging Het
Gan C A 8: 117,183,503 T57K possibly damaging Het
Glra3 T C 8: 56,089,089 V289A probably damaging Het
Grk6 G A 13: 55,452,168 A258T possibly damaging Het
Hars T C 18: 36,771,190 N212S possibly damaging Het
Ikzf2 C A 1: 69,539,095 Q418H probably damaging Het
Ikzf2 T G 1: 69,539,096 Q418P probably damaging Het
Klre1 T A 6: 129,580,026 N30K probably benign Het
Lama5 G T 2: 180,198,787 D606E probably damaging Het
Lca5l T C 16: 96,162,560 K393R probably damaging Het
Lmbrd2 A T 15: 9,156,207 I124F possibly damaging Het
Loxhd1 C A 18: 77,380,460 P935T probably damaging Het
Nes T C 3: 87,978,081 S1216P possibly damaging Het
Nim1k A G 13: 119,712,677 L227P probably damaging Het
Nkx2-1 C A 12: 56,533,056 L366F probably damaging Het
Nol6 C A 4: 41,119,548 R586L possibly damaging Het
Ogdh T A 11: 6,297,174 L66* probably null Het
Olfr1367 A T 13: 21,347,827 I300L probably benign Het
Orm3 A G 4: 63,356,230 S11G possibly damaging Het
Pkn3 C A 2: 30,080,059 S126R probably benign Het
Pnpla8 T A 12: 44,288,308 D442E probably damaging Het
Pop1 A T 15: 34,508,609 T277S probably damaging Het
Prkag2 T C 5: 24,863,870 T563A probably benign Het
Prkdc T A 16: 15,773,613 F2652I possibly damaging Het
Prok1 A G 3: 107,237,197 I30T probably benign Het
Prr9 T G 3: 92,123,049 T95P possibly damaging Het
Ptgds A G 2: 25,469,657 M6T unknown Het
Rnaseh2b T A 14: 62,370,489 D250E probably benign Het
Rundc1 C T 11: 101,433,557 T363M probably damaging Het
Ryr2 T A 13: 11,668,935 H3081L possibly damaging Het
Setmar T C 6: 108,076,163 I206T probably benign Het
Slitrk6 A G 14: 110,752,021 S85P possibly damaging Het
Spi1 A G 2: 91,113,305 N65D probably benign Het
Stx1b A T 7: 127,807,773 probably benign Het
Trav5-4 G A 14: 53,704,293 S41N probably benign Het
Tspan14 T C 14: 40,908,092 D260G probably benign Het
Ube4a T C 9: 44,941,229 D645G possibly damaging Het
Ush2a C T 1: 188,542,865 T1845I probably benign Het
Vps18 T C 2: 119,297,492 L932P probably damaging Het
Wdr61 A T 9: 54,728,255 S21T probably benign Het
Zfp62 T A 11: 49,217,391 C770S probably damaging Het
Zfp672 T C 11: 58,316,802 K231R probably benign Het
Other mutations in Grk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Grk1 APN 8 13413128 nonsense probably null
IGL00501:Grk1 APN 8 13407835 missense probably damaging 1.00
IGL00772:Grk1 APN 8 13405349 missense probably benign
IGL00905:Grk1 APN 8 13416068 missense probably benign 0.32
IGL01116:Grk1 APN 8 13405404 missense possibly damaging 0.52
IGL01976:Grk1 APN 8 13415993 missense probably damaging 1.00
R0463:Grk1 UTSW 8 13409279 missense probably damaging 1.00
R1600:Grk1 UTSW 8 13405406 missense probably benign 0.01
R1838:Grk1 UTSW 8 13416155 missense possibly damaging 0.77
R1911:Grk1 UTSW 8 13407923 missense probably damaging 0.99
R2122:Grk1 UTSW 8 13405221 missense probably benign 0.01
R4583:Grk1 UTSW 8 13409322 missense probably damaging 0.99
R5347:Grk1 UTSW 8 13414478 missense probably damaging 1.00
R5520:Grk1 UTSW 8 13409305 missense probably benign
R5682:Grk1 UTSW 8 13414351 missense possibly damaging 0.88
R6145:Grk1 UTSW 8 13405765 nonsense probably null
R6329:Grk1 UTSW 8 13405704 missense probably damaging 1.00
R6415:Grk1 UTSW 8 13413127 missense probably damaging 1.00
R6717:Grk1 UTSW 8 13416237 missense probably benign 0.01
R7421:Grk1 UTSW 8 13405316 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTATGTCCCTGAGTGAATGC -3'
(R):5'- CTACGACATCACATGCCCTCTG -3'

Sequencing Primer
(F):5'- CGTAGCAGATTTCAGACAGATTGC -3'
(R):5'- TGTCCCCAGTAATCACGGAGAG -3'
Posted On2020-10-20