Incidental Mutation 'R8401:Ddx60'
ID652191
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R8401 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location61928087-62038244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61956243 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 438 (L438F)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398]
Predicted Effect probably benign
Transcript: ENSMUST00000070631
AA Change: L438F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: L438F

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000093485
AA Change: L438F

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: L438F

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154398
AA Change: L438F

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921
AA Change: L438F

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 T C 14: 31,745,294 Y207C probably damaging Het
Ano8 T C 8: 71,483,367 D235G probably damaging Het
Atp2b4 T A 1: 133,731,836 I463F probably damaging Het
Brca2 T A 5: 150,552,352 I2509N probably damaging Het
Brinp3 T C 1: 146,901,446 S544P probably benign Het
Chd1 A G 17: 15,743,211 Y824C probably damaging Het
Dapk1 T C 13: 60,723,090 V330A probably benign Het
Dct T C 14: 118,043,203 T134A possibly damaging Het
Ddx56 T C 11: 6,264,199 D350G probably damaging Het
Dnah17 T A 11: 118,024,659 K4378M probably damaging Het
Drc7 C T 8: 95,074,135 S595F probably benign Het
Epb41 C T 4: 131,974,707 R539Q probably damaging Het
Foxred2 T C 15: 77,951,991 I389V probably damaging Het
Gan C A 8: 117,183,503 T57K possibly damaging Het
Glra3 T C 8: 56,089,089 V289A probably damaging Het
Grk1 T C 8: 13,407,846 F249L probably damaging Het
Grk6 G A 13: 55,452,168 A258T possibly damaging Het
Hars T C 18: 36,771,190 N212S possibly damaging Het
Ikzf2 C A 1: 69,539,095 Q418H probably damaging Het
Ikzf2 T G 1: 69,539,096 Q418P probably damaging Het
Klre1 T A 6: 129,580,026 N30K probably benign Het
Lama5 G T 2: 180,198,787 D606E probably damaging Het
Lca5l T C 16: 96,162,560 K393R probably damaging Het
Lmbrd2 A T 15: 9,156,207 I124F possibly damaging Het
Loxhd1 C A 18: 77,380,460 P935T probably damaging Het
Nes T C 3: 87,978,081 S1216P possibly damaging Het
Nim1k A G 13: 119,712,677 L227P probably damaging Het
Nkx2-1 C A 12: 56,533,056 L366F probably damaging Het
Nol6 C A 4: 41,119,548 R586L possibly damaging Het
Ogdh T A 11: 6,297,174 L66* probably null Het
Olfr1367 A T 13: 21,347,827 I300L probably benign Het
Orm3 A G 4: 63,356,230 S11G possibly damaging Het
Pkn3 C A 2: 30,080,059 S126R probably benign Het
Pnpla8 T A 12: 44,288,308 D442E probably damaging Het
Pop1 A T 15: 34,508,609 T277S probably damaging Het
Prkag2 T C 5: 24,863,870 T563A probably benign Het
Prkdc T A 16: 15,773,613 F2652I possibly damaging Het
Prok1 A G 3: 107,237,197 I30T probably benign Het
Prr9 T G 3: 92,123,049 T95P possibly damaging Het
Ptgds A G 2: 25,469,657 M6T unknown Het
Rnaseh2b T A 14: 62,370,489 D250E probably benign Het
Rundc1 C T 11: 101,433,557 T363M probably damaging Het
Ryr2 T A 13: 11,668,935 H3081L possibly damaging Het
Setmar T C 6: 108,076,163 I206T probably benign Het
Slitrk6 A G 14: 110,752,021 S85P possibly damaging Het
Spi1 A G 2: 91,113,305 N65D probably benign Het
Stx1b A T 7: 127,807,773 probably benign Het
Trav5-4 G A 14: 53,704,293 S41N probably benign Het
Tspan14 T C 14: 40,908,092 D260G probably benign Het
Ube4a T C 9: 44,941,229 D645G possibly damaging Het
Ush2a C T 1: 188,542,865 T1845I probably benign Het
Vps18 T C 2: 119,297,492 L932P probably damaging Het
Wdr61 A T 9: 54,728,255 S21T probably benign Het
Zfp62 T A 11: 49,217,391 C770S probably damaging Het
Zfp672 T C 11: 58,316,802 K231R probably benign Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8487:Ddx60 UTSW 8 61974150 missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61958606 missense probably benign 0.27
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTCTAGGCATGAGTCAGTGGTAC -3'
(R):5'- AGAATCTGAGTGTCTTTCATCCAC -3'

Sequencing Primer
(F):5'- CTGAGTAATTTTAATTTGGTCCAGGC -3'
(R):5'- CACAAAGAAAATCTTCAGTTGCTAG -3'
Posted On2020-10-20