Incidental Mutation 'R8401:Pop1'
ID 652216
Institutional Source Beutler Lab
Gene Symbol Pop1
Ensembl Gene ENSMUSG00000022325
Gene Name processing of precursor 1, ribonuclease P/MRP family, (S. cerevisiae)
Synonyms 4932434G09Rik
MMRRC Submission 067877-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R8401 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 34495457-34530799 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 34508755 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 277 (T277S)
Ref Sequence ENSEMBL: ENSMUSP00000052654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052290] [ENSMUST00000079028]
AlphaFold Q8K205
Predicted Effect probably damaging
Transcript: ENSMUST00000052290
AA Change: T277S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052654
Gene: ENSMUSG00000022325
AA Change: T277S

DomainStartEndE-ValueType
Pfam:POP1 107 190 6.2e-21 PFAM
Pfam:POP1 179 257 2.5e-23 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 647 738 1.4e-30 PFAM
low complexity region 931 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079028
AA Change: T277S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078037
Gene: ENSMUSG00000022325
AA Change: T277S

DomainStartEndE-ValueType
Pfam:POP1 107 258 1e-46 PFAM
low complexity region 382 387 N/A INTRINSIC
Pfam:POPLD 617 708 1.2e-34 PFAM
low complexity region 901 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the protein subunit of two different small nucleolar ribonucleoprotein complexes: the endoribonuclease for mitochondrial RNA processing complex and the ribonuclease P complex. The encoded protein is a ribonuclease that localizes to the nucleus and functions in pre-RNA processing. This protein is also an autoantigen in patients suffering from connective tissue diseases. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 T C 14: 31,467,251 (GRCm39) Y207C probably damaging Het
Ano8 T C 8: 71,936,011 (GRCm39) D235G probably damaging Het
Atp2b4 T A 1: 133,659,574 (GRCm39) I463F probably damaging Het
Brca2 T A 5: 150,475,817 (GRCm39) I2509N probably damaging Het
Brinp3 T C 1: 146,777,184 (GRCm39) S544P probably benign Het
Chd1 A G 17: 15,963,473 (GRCm39) Y824C probably damaging Het
Dapk1 T C 13: 60,870,904 (GRCm39) V330A probably benign Het
Dct T C 14: 118,280,615 (GRCm39) T134A possibly damaging Het
Ddx56 T C 11: 6,214,199 (GRCm39) D350G probably damaging Het
Ddx60 C T 8: 62,409,277 (GRCm39) L438F possibly damaging Het
Dnah17 T A 11: 117,915,485 (GRCm39) K4378M probably damaging Het
Drc7 C T 8: 95,800,763 (GRCm39) S595F probably benign Het
Epb41 C T 4: 131,702,018 (GRCm39) R539Q probably damaging Het
Foxred2 T C 15: 77,836,191 (GRCm39) I389V probably damaging Het
Gan C A 8: 117,910,242 (GRCm39) T57K possibly damaging Het
Glra3 T C 8: 56,542,124 (GRCm39) V289A probably damaging Het
Grk1 T C 8: 13,457,846 (GRCm39) F249L probably damaging Het
Grk6 G A 13: 55,599,981 (GRCm39) A258T possibly damaging Het
Hars1 T C 18: 36,904,243 (GRCm39) N212S possibly damaging Het
Ikzf2 C A 1: 69,578,254 (GRCm39) Q418H probably damaging Het
Ikzf2 T G 1: 69,578,255 (GRCm39) Q418P probably damaging Het
Klre1 T A 6: 129,556,989 (GRCm39) N30K probably benign Het
Lama5 G T 2: 179,840,580 (GRCm39) D606E probably damaging Het
Lca5l T C 16: 95,963,760 (GRCm39) K393R probably damaging Het
Lmbrd2 A T 15: 9,156,294 (GRCm39) I124F possibly damaging Het
Loxhd1 C A 18: 77,468,156 (GRCm39) P935T probably damaging Het
Nes T C 3: 87,885,388 (GRCm39) S1216P possibly damaging Het
Nim1k A G 13: 120,174,213 (GRCm39) L227P probably damaging Het
Nkx2-1 C A 12: 56,579,841 (GRCm39) L366F probably damaging Het
Nol6 C A 4: 41,119,548 (GRCm39) R586L possibly damaging Het
Ogdh T A 11: 6,247,174 (GRCm39) L66* probably null Het
Or2b28 A T 13: 21,531,997 (GRCm39) I300L probably benign Het
Orm3 A G 4: 63,274,467 (GRCm39) S11G possibly damaging Het
Pkn3 C A 2: 29,970,071 (GRCm39) S126R probably benign Het
Pnpla8 T A 12: 44,335,091 (GRCm39) D442E probably damaging Het
Prkag2 T C 5: 25,068,868 (GRCm39) T563A probably benign Het
Prkdc T A 16: 15,591,477 (GRCm39) F2652I possibly damaging Het
Prok1 A G 3: 107,144,513 (GRCm39) I30T probably benign Het
Prr9 T G 3: 92,030,356 (GRCm39) T95P possibly damaging Het
Ptgds A G 2: 25,359,669 (GRCm39) M6T unknown Het
Rnaseh2b T A 14: 62,607,938 (GRCm39) D250E probably benign Het
Rundc1 C T 11: 101,324,383 (GRCm39) T363M probably damaging Het
Ryr2 T A 13: 11,683,821 (GRCm39) H3081L possibly damaging Het
Setmar T C 6: 108,053,124 (GRCm39) I206T probably benign Het
Skic8 A T 9: 54,635,539 (GRCm39) S21T probably benign Het
Slitrk6 A G 14: 110,989,453 (GRCm39) S85P possibly damaging Het
Spi1 A G 2: 90,943,650 (GRCm39) N65D probably benign Het
Stx1b A T 7: 127,406,945 (GRCm39) probably benign Het
Trav5-4 G A 14: 53,941,750 (GRCm39) S41N probably benign Het
Tspan14 T C 14: 40,630,049 (GRCm39) D260G probably benign Het
Ube4a T C 9: 44,852,527 (GRCm39) D645G possibly damaging Het
Ush2a C T 1: 188,275,062 (GRCm39) T1845I probably benign Het
Vps18 T C 2: 119,127,973 (GRCm39) L932P probably damaging Het
Zfp62 T A 11: 49,108,218 (GRCm39) C770S probably damaging Het
Zfp672 T C 11: 58,207,628 (GRCm39) K231R probably benign Het
Other mutations in Pop1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Pop1 APN 15 34,508,875 (GRCm39) missense probably benign 0.00
IGL02192:Pop1 APN 15 34,529,217 (GRCm39) missense probably benign 0.08
IGL02680:Pop1 APN 15 34,502,619 (GRCm39) missense probably damaging 0.99
IGL02958:Pop1 APN 15 34,530,509 (GRCm39) missense probably damaging 0.99
H8562:Pop1 UTSW 15 34,530,358 (GRCm39) missense probably benign 0.00
PIT4802001:Pop1 UTSW 15 34,529,229 (GRCm39) missense probably benign 0.00
R0244:Pop1 UTSW 15 34,516,037 (GRCm39) nonsense probably null
R0281:Pop1 UTSW 15 34,530,004 (GRCm39) splice site probably null
R0453:Pop1 UTSW 15 34,526,352 (GRCm39) missense possibly damaging 0.82
R0579:Pop1 UTSW 15 34,510,115 (GRCm39) missense possibly damaging 0.68
R1054:Pop1 UTSW 15 34,509,955 (GRCm39) missense probably benign 0.30
R1501:Pop1 UTSW 15 34,510,503 (GRCm39) missense probably benign 0.01
R1614:Pop1 UTSW 15 34,530,356 (GRCm39) missense possibly damaging 0.46
R1994:Pop1 UTSW 15 34,530,617 (GRCm39) missense probably damaging 1.00
R2084:Pop1 UTSW 15 34,508,744 (GRCm39) splice site probably benign
R4020:Pop1 UTSW 15 34,508,926 (GRCm39) missense probably benign 0.01
R4550:Pop1 UTSW 15 34,529,082 (GRCm39) missense probably damaging 1.00
R4579:Pop1 UTSW 15 34,515,970 (GRCm39) intron probably benign
R5672:Pop1 UTSW 15 34,530,325 (GRCm39) missense possibly damaging 0.63
R6139:Pop1 UTSW 15 34,529,204 (GRCm39) missense probably benign 0.26
R6161:Pop1 UTSW 15 34,526,456 (GRCm39) missense probably damaging 1.00
R6821:Pop1 UTSW 15 34,508,785 (GRCm39) missense possibly damaging 0.86
R7053:Pop1 UTSW 15 34,530,421 (GRCm39) missense probably benign 0.01
R7195:Pop1 UTSW 15 34,510,525 (GRCm39) missense probably damaging 0.97
R7543:Pop1 UTSW 15 34,530,593 (GRCm39) missense probably damaging 1.00
R7571:Pop1 UTSW 15 34,529,093 (GRCm39) missense probably null 1.00
R7587:Pop1 UTSW 15 34,502,559 (GRCm39) missense probably damaging 0.97
R8406:Pop1 UTSW 15 34,529,316 (GRCm39) missense probably benign
R8707:Pop1 UTSW 15 34,529,349 (GRCm39) missense probably benign 0.02
R9044:Pop1 UTSW 15 34,530,554 (GRCm39) missense possibly damaging 0.94
R9066:Pop1 UTSW 15 34,516,060 (GRCm39) missense possibly damaging 0.68
R9236:Pop1 UTSW 15 34,499,558 (GRCm39) missense probably damaging 0.98
R9600:Pop1 UTSW 15 34,512,881 (GRCm39) missense probably benign 0.06
R9711:Pop1 UTSW 15 34,530,227 (GRCm39) missense probably benign
RF001:Pop1 UTSW 15 34,502,583 (GRCm39) missense probably damaging 1.00
RF002:Pop1 UTSW 15 34,502,583 (GRCm39) missense probably damaging 1.00
Z1088:Pop1 UTSW 15 34,499,465 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGGCAGAAACACCTTGAAACTC -3'
(R):5'- ACGCGTGTACGGTTAAATCC -3'

Sequencing Primer
(F):5'- ACACCTTGAAACTCACTAAATCATTG -3'
(R):5'- TACCAGTTTAAGAGTTGGGTGAAGCC -3'
Posted On 2020-10-20