Incidental Mutation 'R8401:Lca5l'
ID652219
Institutional Source Beutler Lab
Gene Symbol Lca5l
Ensembl Gene ENSMUSG00000045275
Gene NameLeber congenital amaurosis 5-like
Synonyms4921526F01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R8401 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location96158407-96192257 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96162560 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 393 (K393R)
Ref Sequence ENSEMBL: ENSMUSP00000061337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023913] [ENSMUST00000054855] [ENSMUST00000113804]
Predicted Effect probably benign
Transcript: ENSMUST00000023913
SMART Domains Protein: ENSMUSP00000023913
Gene: ENSMUSG00000023147

DomainStartEndE-ValueType
Pfam:CHD5 12 163 1.4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054855
AA Change: K393R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000061337
Gene: ENSMUSG00000045275
AA Change: K393R

DomainStartEndE-ValueType
low complexity region 39 53 N/A INTRINSIC
Pfam:Lebercilin 144 336 5.6e-68 PFAM
low complexity region 528 544 N/A INTRINSIC
low complexity region 654 670 N/A INTRINSIC
low complexity region 679 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113804
AA Change: K388R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109435
Gene: ENSMUSG00000045275
AA Change: K388R

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
Pfam:Lebercilin 138 331 1.9e-71 PFAM
low complexity region 523 539 N/A INTRINSIC
low complexity region 649 665 N/A INTRINSIC
low complexity region 674 683 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 T C 14: 31,745,294 Y207C probably damaging Het
Ano8 T C 8: 71,483,367 D235G probably damaging Het
Atp2b4 T A 1: 133,731,836 I463F probably damaging Het
Brca2 T A 5: 150,552,352 I2509N probably damaging Het
Brinp3 T C 1: 146,901,446 S544P probably benign Het
Chd1 A G 17: 15,743,211 Y824C probably damaging Het
Dapk1 T C 13: 60,723,090 V330A probably benign Het
Dct T C 14: 118,043,203 T134A possibly damaging Het
Ddx56 T C 11: 6,264,199 D350G probably damaging Het
Ddx60 C T 8: 61,956,243 L438F possibly damaging Het
Dnah17 T A 11: 118,024,659 K4378M probably damaging Het
Drc7 C T 8: 95,074,135 S595F probably benign Het
Epb41 C T 4: 131,974,707 R539Q probably damaging Het
Foxred2 T C 15: 77,951,991 I389V probably damaging Het
Gan C A 8: 117,183,503 T57K possibly damaging Het
Glra3 T C 8: 56,089,089 V289A probably damaging Het
Grk1 T C 8: 13,407,846 F249L probably damaging Het
Grk6 G A 13: 55,452,168 A258T possibly damaging Het
Hars T C 18: 36,771,190 N212S possibly damaging Het
Ikzf2 C A 1: 69,539,095 Q418H probably damaging Het
Ikzf2 T G 1: 69,539,096 Q418P probably damaging Het
Klre1 T A 6: 129,580,026 N30K probably benign Het
Lama5 G T 2: 180,198,787 D606E probably damaging Het
Lmbrd2 A T 15: 9,156,207 I124F possibly damaging Het
Loxhd1 C A 18: 77,380,460 P935T probably damaging Het
Nes T C 3: 87,978,081 S1216P possibly damaging Het
Nim1k A G 13: 119,712,677 L227P probably damaging Het
Nkx2-1 C A 12: 56,533,056 L366F probably damaging Het
Nol6 C A 4: 41,119,548 R586L possibly damaging Het
Ogdh T A 11: 6,297,174 L66* probably null Het
Olfr1367 A T 13: 21,347,827 I300L probably benign Het
Orm3 A G 4: 63,356,230 S11G possibly damaging Het
Pkn3 C A 2: 30,080,059 S126R probably benign Het
Pnpla8 T A 12: 44,288,308 D442E probably damaging Het
Pop1 A T 15: 34,508,609 T277S probably damaging Het
Prkag2 T C 5: 24,863,870 T563A probably benign Het
Prkdc T A 16: 15,773,613 F2652I possibly damaging Het
Prok1 A G 3: 107,237,197 I30T probably benign Het
Prr9 T G 3: 92,123,049 T95P possibly damaging Het
Ptgds A G 2: 25,469,657 M6T unknown Het
Rnaseh2b T A 14: 62,370,489 D250E probably benign Het
Rundc1 C T 11: 101,433,557 T363M probably damaging Het
Ryr2 T A 13: 11,668,935 H3081L possibly damaging Het
Setmar T C 6: 108,076,163 I206T probably benign Het
Slitrk6 A G 14: 110,752,021 S85P possibly damaging Het
Spi1 A G 2: 91,113,305 N65D probably benign Het
Stx1b A T 7: 127,807,773 probably benign Het
Trav5-4 G A 14: 53,704,293 S41N probably benign Het
Tspan14 T C 14: 40,908,092 D260G probably benign Het
Ube4a T C 9: 44,941,229 D645G possibly damaging Het
Ush2a C T 1: 188,542,865 T1845I probably benign Het
Vps18 T C 2: 119,297,492 L932P probably damaging Het
Wdr61 A T 9: 54,728,255 S21T probably benign Het
Zfp62 T A 11: 49,217,391 C770S probably damaging Het
Zfp672 T C 11: 58,316,802 K231R probably benign Het
Other mutations in Lca5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00667:Lca5l APN 16 96161412 missense possibly damaging 0.90
IGL02893:Lca5l APN 16 96178913 missense probably benign 0.01
IGL03056:Lca5l APN 16 96161351 missense probably benign 0.26
IGL03208:Lca5l APN 16 96178846 missense probably damaging 0.98
IGL03267:Lca5l APN 16 96159783 missense probably benign 0.03
R0417:Lca5l UTSW 16 96162653 missense probably damaging 1.00
R0961:Lca5l UTSW 16 96161360 missense possibly damaging 0.90
R1458:Lca5l UTSW 16 96159859 missense possibly damaging 0.95
R1650:Lca5l UTSW 16 96178940 critical splice acceptor site probably null
R1669:Lca5l UTSW 16 96159808 missense possibly damaging 0.95
R1706:Lca5l UTSW 16 96175964 missense probably benign 0.41
R2004:Lca5l UTSW 16 96162649 missense probably damaging 1.00
R2004:Lca5l UTSW 16 96176018 missense possibly damaging 0.95
R4291:Lca5l UTSW 16 96178774 missense probably damaging 1.00
R4307:Lca5l UTSW 16 96159556 unclassified probably benign
R4824:Lca5l UTSW 16 96162029 nonsense probably null
R4920:Lca5l UTSW 16 96178835 missense probably damaging 1.00
R4991:Lca5l UTSW 16 96159732 missense possibly damaging 0.90
R5591:Lca5l UTSW 16 96178729 missense probably damaging 1.00
R5774:Lca5l UTSW 16 96176061 missense probably benign 0.22
R6243:Lca5l UTSW 16 96178912 missense possibly damaging 0.90
R6403:Lca5l UTSW 16 96173845 missense probably benign 0.41
R7153:Lca5l UTSW 16 96173809 missense probably damaging 0.98
R7754:Lca5l UTSW 16 96159561 missense unknown
R7758:Lca5l UTSW 16 96178837 missense probably benign 0.00
R7814:Lca5l UTSW 16 96162557 critical splice donor site probably null
R8357:Lca5l UTSW 16 96159708 missense possibly damaging 0.95
R8457:Lca5l UTSW 16 96159708 missense possibly damaging 0.95
R8527:Lca5l UTSW 16 96159238 missense probably damaging 1.00
R8807:Lca5l UTSW 16 96178608 missense probably benign 0.01
RF031:Lca5l UTSW 16 96159304 frame shift probably null
RF042:Lca5l UTSW 16 96159297 frame shift probably null
RF050:Lca5l UTSW 16 96159301 small deletion probably benign
RF059:Lca5l UTSW 16 96159301 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACAACAAGTGACTGCTTTTAGTC -3'
(R):5'- AACTCTGACTGTGTGTTGCC -3'

Sequencing Primer
(F):5'- GACTGCTTTTAGTCACTTTGCTC -3'
(R):5'- GCCTGTCCTTTAGTGTGAGC -3'
Posted On2020-10-20