Incidental Mutation 'R8401:Chd1'
ID652220
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8401 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15743211 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 824 (Y824C)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
Predicted Effect probably damaging
Transcript: ENSMUST00000024627
AA Change: Y824C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: Y824C

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173311
AA Change: Y824C

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: Y824C

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000134718
Gene: ENSMUSG00000023852
AA Change: Y208C

DomainStartEndE-ValueType
Pfam:SNF2_N 1 148 3.6e-34 PFAM
low complexity region 172 184 N/A INTRINSIC
HELICc 201 285 8.48e-25 SMART
Blast:DEXDc 340 516 1e-47 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd28 T C 14: 31,745,294 Y207C probably damaging Het
Ano8 T C 8: 71,483,367 D235G probably damaging Het
Atp2b4 T A 1: 133,731,836 I463F probably damaging Het
Brca2 T A 5: 150,552,352 I2509N probably damaging Het
Brinp3 T C 1: 146,901,446 S544P probably benign Het
Dapk1 T C 13: 60,723,090 V330A probably benign Het
Dct T C 14: 118,043,203 T134A possibly damaging Het
Ddx56 T C 11: 6,264,199 D350G probably damaging Het
Ddx60 C T 8: 61,956,243 L438F possibly damaging Het
Dnah17 T A 11: 118,024,659 K4378M probably damaging Het
Drc7 C T 8: 95,074,135 S595F probably benign Het
Epb41 C T 4: 131,974,707 R539Q probably damaging Het
Foxred2 T C 15: 77,951,991 I389V probably damaging Het
Gan C A 8: 117,183,503 T57K possibly damaging Het
Glra3 T C 8: 56,089,089 V289A probably damaging Het
Grk1 T C 8: 13,407,846 F249L probably damaging Het
Grk6 G A 13: 55,452,168 A258T possibly damaging Het
Hars T C 18: 36,771,190 N212S possibly damaging Het
Ikzf2 C A 1: 69,539,095 Q418H probably damaging Het
Ikzf2 T G 1: 69,539,096 Q418P probably damaging Het
Klre1 T A 6: 129,580,026 N30K probably benign Het
Lama5 G T 2: 180,198,787 D606E probably damaging Het
Lca5l T C 16: 96,162,560 K393R probably damaging Het
Lmbrd2 A T 15: 9,156,207 I124F possibly damaging Het
Loxhd1 C A 18: 77,380,460 P935T probably damaging Het
Nes T C 3: 87,978,081 S1216P possibly damaging Het
Nim1k A G 13: 119,712,677 L227P probably damaging Het
Nkx2-1 C A 12: 56,533,056 L366F probably damaging Het
Nol6 C A 4: 41,119,548 R586L possibly damaging Het
Ogdh T A 11: 6,297,174 L66* probably null Het
Olfr1367 A T 13: 21,347,827 I300L probably benign Het
Orm3 A G 4: 63,356,230 S11G possibly damaging Het
Pkn3 C A 2: 30,080,059 S126R probably benign Het
Pnpla8 T A 12: 44,288,308 D442E probably damaging Het
Pop1 A T 15: 34,508,609 T277S probably damaging Het
Prkag2 T C 5: 24,863,870 T563A probably benign Het
Prkdc T A 16: 15,773,613 F2652I possibly damaging Het
Prok1 A G 3: 107,237,197 I30T probably benign Het
Prr9 T G 3: 92,123,049 T95P possibly damaging Het
Ptgds A G 2: 25,469,657 M6T unknown Het
Rnaseh2b T A 14: 62,370,489 D250E probably benign Het
Rundc1 C T 11: 101,433,557 T363M probably damaging Het
Ryr2 T A 13: 11,668,935 H3081L possibly damaging Het
Setmar T C 6: 108,076,163 I206T probably benign Het
Slitrk6 A G 14: 110,752,021 S85P possibly damaging Het
Spi1 A G 2: 91,113,305 N65D probably benign Het
Stx1b A T 7: 127,807,773 probably benign Het
Trav5-4 G A 14: 53,704,293 S41N probably benign Het
Tspan14 T C 14: 40,908,092 D260G probably benign Het
Ube4a T C 9: 44,941,229 D645G possibly damaging Het
Ush2a C T 1: 188,542,865 T1845I probably benign Het
Vps18 T C 2: 119,297,492 L932P probably damaging Het
Wdr61 A T 9: 54,728,255 S21T probably benign Het
Zfp62 T A 11: 49,217,391 C770S probably damaging Het
Zfp672 T C 11: 58,316,802 K231R probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTTACCACGTTGTAATAGGTG -3'
(R):5'- AAAGCTTGCCCTTCAGACCC -3'

Sequencing Primer
(F):5'- ACCACGTTGTAATAGGTGTACTCTGC -3'
(R):5'- TTAGCACAGAAATACCACTTTAGTCC -3'
Posted On2020-10-20