Mutagenetix > Incidental Mutation

Incidental Mutation 'R8402:Anapc1'

652226

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

Apc1, tsg24, Mcpr, 2610021O03Rik

MMRRC Submission

067878-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8402 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128452024-128529311 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 128472148 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 1458 (S1458L)

Ref Sequence

ENSEMBL: ENSMUSP00000014499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499]

AlphaFold

P53995

Predicted Effect

probably benign
Transcript: ENSMUST00000014499
AA Change: S1458L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: S1458L

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

100% (36/36)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts12	A	T	15: 11,263,376 (GRCm39)	K579N	probably damaging	Het
Adcy7	T	C	8: 89,035,363 (GRCm39)	V89A	probably benign	Het
AW551984	T	C	9: 39,508,949 (GRCm39)	Y325C	probably damaging	Het
Btnl4	T	C	17: 34,688,467 (GRCm39)	Y437C	probably damaging	Het
Ccdc88a	T	A	11: 29,413,879 (GRCm39)	S806T	probably damaging	Het
Clec2m	T	A	6: 129,300,007 (GRCm39)	D157V	possibly damaging	Het
Ddit4l	A	G	3: 137,331,888 (GRCm39)	T85A	probably damaging	Het
Dmxl1	G	A	18: 50,011,393 (GRCm39)	W1183*	probably null	Het
Dmxl1	G	T	18: 50,011,409 (GRCm39)	V1189L	probably benign	Het
Dmxl1	G	C	18: 50,011,394 (GRCm39)	D1184H	probably benign	Het
Evpl	T	C	11: 116,116,197 (GRCm39)	D820G	probably benign	Het
Fam76b	T	C	9: 13,750,972 (GRCm39)	S289P	probably damaging	Het
Fan1	T	A	7: 64,022,234 (GRCm39)	N340Y	probably damaging	Het
Gabrb2	T	C	11: 42,378,131 (GRCm39)	W116R	probably damaging	Het
Galnt7	G	A	8: 57,995,953 (GRCm39)	A355V	probably damaging	Het
Klk1b5	T	G	7: 43,867,962 (GRCm39)	F45V	probably benign	Het
Nav2	T	C	7: 49,103,185 (GRCm39)	V661A	probably benign	Het
Nfkbiz	T	C	16: 55,636,750 (GRCm39)	N517S	probably damaging	Het
Or10ak16	A	G	4: 118,750,716 (GRCm39)	I145M	probably benign	Het
Or10d5	T	A	9: 39,861,713 (GRCm39)	Y118F	probably benign	Het
P2rx1	T	C	11: 72,904,715 (GRCm39)	F368L	probably damaging	Het
Palld	A	T	8: 62,164,440 (GRCm39)	V417E	probably damaging	Het
Robo1	C	A	16: 72,821,385 (GRCm39)	A1375E	probably benign	Het
Rps24	G	T	14: 24,540,829 (GRCm39)		probably benign	Het
Serpind1	A	G	16: 17,154,949 (GRCm39)	N259D	probably benign	Het
Sh3bp4	C	A	1: 89,073,037 (GRCm39)	N628K	probably benign	Het
Tada3	A	T	6: 113,351,774 (GRCm39)	L177Q	probably damaging	Het
Tcam1	T	A	11: 106,177,731 (GRCm39)	L508Q	probably damaging	Het
Thbs1	T	C	2: 117,946,359 (GRCm39)	S360P	possibly damaging	Het
Tmem33	T	C	5: 67,424,718 (GRCm39)		probably benign	Het
Vmn2r3	A	G	3: 64,178,617 (GRCm39)		probably benign	Het
Vwa3b	A	G	1: 37,204,879 (GRCm39)	E121G	probably damaging	Het
Zfp607b	T	A	7: 27,402,127 (GRCm39)	H194Q	probably damaging	Het
Zfp729b	G	A	13: 67,740,696 (GRCm39)	P523L	probably damaging	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128,487,050 (GRCm39)	splice site	probably benign
IGL00704:Anapc1	APN	2	128,505,904 (GRCm39)	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128,471,649 (GRCm39)	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128,475,328 (GRCm39)	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128,495,090 (GRCm39)	missense	probably benign
IGL02089:Anapc1	APN	2	128,505,853 (GRCm39)	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128,501,772 (GRCm39)	missense	probably benign
IGL02570:Anapc1	APN	2	128,487,120 (GRCm39)	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128,465,851 (GRCm39)	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128,501,705 (GRCm39)	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128,469,117 (GRCm39)	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128,469,033 (GRCm39)	splice site	probably benign
IGL03327:Anapc1	APN	2	128,465,854 (GRCm39)	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128,520,138 (GRCm39)	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128,465,886 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128,476,631 (GRCm39)	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128,483,260 (GRCm39)	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128,510,963 (GRCm39)	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128,474,575 (GRCm39)	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128,461,252 (GRCm39)	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128,459,651 (GRCm39)	missense	probably benign
R1175:Anapc1	UTSW	2	128,522,108 (GRCm39)	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128,459,617 (GRCm39)	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128,459,476 (GRCm39)	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128,466,819 (GRCm39)	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128,459,636 (GRCm39)	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128,470,452 (GRCm39)	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128,500,166 (GRCm39)	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128,518,128 (GRCm39)	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128,517,810 (GRCm39)	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128,501,708 (GRCm39)	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128,475,335 (GRCm39)	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128,511,608 (GRCm39)	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128,490,378 (GRCm39)	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128,484,468 (GRCm39)	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128,522,057 (GRCm39)	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128,484,602 (GRCm39)	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128,484,439 (GRCm39)	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128,469,149 (GRCm39)	intron	probably benign
R4359:Anapc1	UTSW	2	128,465,476 (GRCm39)	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128,518,169 (GRCm39)	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128,469,115 (GRCm39)	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128,505,925 (GRCm39)	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128,527,980 (GRCm39)	splice site	probably benign
R4824:Anapc1	UTSW	2	128,470,610 (GRCm39)	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128,526,514 (GRCm39)	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128,449,095 (GRCm39)	unclassified	probably benign
R5063:Anapc1	UTSW	2	128,471,469 (GRCm39)	missense	possibly damaging	0.48
R5128:Anapc1	UTSW	2	128,501,837 (GRCm39)	missense	probably benign
R5271:Anapc1	UTSW	2	128,527,905 (GRCm39)	nonsense	probably null
R5363:Anapc1	UTSW	2	128,492,114 (GRCm39)	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128,517,621 (GRCm39)	nonsense	probably null
R5473:Anapc1	UTSW	2	128,449,115 (GRCm39)	unclassified	probably benign
R5559:Anapc1	UTSW	2	128,522,354 (GRCm39)	nonsense	probably null
R5631:Anapc1	UTSW	2	128,499,137 (GRCm39)	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128,466,836 (GRCm39)	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128,448,957 (GRCm39)	unclassified	probably benign
R6226:Anapc1	UTSW	2	128,492,292 (GRCm39)	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128,514,055 (GRCm39)	nonsense	probably null
R6561:Anapc1	UTSW	2	128,505,919 (GRCm39)	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128,526,454 (GRCm39)	nonsense	probably null
R6799:Anapc1	UTSW	2	128,501,657 (GRCm39)	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128,501,688 (GRCm39)	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128,511,820 (GRCm39)	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128,490,601 (GRCm39)	splice site	probably null
R7041:Anapc1	UTSW	2	128,470,576 (GRCm39)	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128,457,350 (GRCm39)	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128,520,194 (GRCm39)	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128,516,522 (GRCm39)	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128,454,930 (GRCm39)	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128,516,604 (GRCm39)	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128,483,457 (GRCm39)	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128,526,528 (GRCm39)	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128,511,828 (GRCm39)	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128,516,513 (GRCm39)	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128,490,408 (GRCm39)	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128,474,547 (GRCm39)	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128,461,837 (GRCm39)	nonsense	probably null
R8422:Anapc1	UTSW	2	128,517,757 (GRCm39)	missense	probably benign
R8425:Anapc1	UTSW	2	128,511,788 (GRCm39)	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128,500,264 (GRCm39)	splice site	probably null
R8553:Anapc1	UTSW	2	128,461,833 (GRCm39)	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128,527,748 (GRCm39)	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128,483,373 (GRCm39)	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128,483,369 (GRCm39)	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128,464,333 (GRCm39)	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128,505,952 (GRCm39)	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128,483,322 (GRCm39)	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128,476,628 (GRCm39)	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128,464,426 (GRCm39)	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128,465,422 (GRCm39)	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128,464,420 (GRCm39)	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128,459,642 (GRCm39)	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128,476,598 (GRCm39)	missense	probably benign
R9436:Anapc1	UTSW	2	128,518,045 (GRCm39)	missense	probably benign
R9516:Anapc1	UTSW	2	128,517,633 (GRCm39)	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128,505,980 (GRCm39)	nonsense	probably null
R9572:Anapc1	UTSW	2	128,505,976 (GRCm39)	missense	probably benign
R9757:Anapc1	UTSW	2	128,517,676 (GRCm39)	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128,500,221 (GRCm39)	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128,516,621 (GRCm39)	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- GGACACCTTTAAAGTGTTCCTCAC -3'
(R):5'- GGAAGTGTCTACTGTCAAAACTG -3'

Sequencing Primer
(F):5'- GATCTGACAGGTGCTAAC -3'
(R):5'- TGTCAAAACTGAAATTACCTGTTACC -3'

Posted On

2020-10-20